View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1332_low_14 (Length: 349)
Name: NF1332_low_14
Description: NF1332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1332_low_14 |
 | |
|
| [»] scaffold0693 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 6 - 236
Target Start/End: Complemental strand, 5982628 - 5982398
Alignment:
| Q |
6 |
gtcgaataatatgcccagtagcagtgtaacatgctttgtgggaaaacaaagaataatgctttgcataaagtttggccgaaacattaaatttaagtcatta |
105 |
Q |
| |
|
||||||||| ||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982628 |
gtcgaataacatgtccagtagcaatgtaacatgctttgtgggaaaacaaagaataatgctttgcataaagtttggccgaaacattaaatttaagtcatta |
5982529 |
T |
|
| Q |
106 |
tatctaagataaatacaaaagtgttaaaaataaggtttaaattagatattagtctcatcaaatataccactttttacttttaaacaataaaaaatatatt |
205 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982528 |
tatctaagataaatacaaaagtattaaaaataaggtttaaattagatattagtctcatcaaatataccactttttacttttaaacaataaaaaatatatt |
5982429 |
T |
|
| Q |
206 |
tttaatccttgcaaatatatcaccttttact |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5982428 |
tttaatccttgcaaatatatcaccttttact |
5982398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 259 - 343
Target Start/End: Complemental strand, 46269784 - 46269700
Alignment:
| Q |
259 |
accgttacggatgaggtttcctcgtcttttttctttgacgttggaaaaggagagtacggtgagggatatggagaggcgtagttgg |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
46269784 |
accgttacggatgaggtttcctcgtcttttttctttgacgttggaaaaggagagtacgacgagggatatggagaggcgtggttgg |
46269700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 259 - 343
Target Start/End: Original strand, 48241628 - 48241712
Alignment:
| Q |
259 |
accgttacggatgaggtttcctcgtcttttttctttgacgttggaaaaggagagtacggtgagggatatggagaggcgtagttgg |
343 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48241628 |
accgttacggaggaggtttcctcgtcttttcaatttgacgatggaaaaggagagtacggtgagggatatggagaggcgtggttgg |
48241712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 9 - 60
Target Start/End: Complemental strand, 5978830 - 5978779
Alignment:
| Q |
9 |
gaataatatgcccagtagcagtgtaacatgctttgtgggaaaacaaagaata |
60 |
Q |
| |
|
|||||| ||| ||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
5978830 |
gaataacatgtccagtagcaatgtaacatgctttgtaggagaacaaagaata |
5978779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 301 - 343
Target Start/End: Complemental strand, 139 - 97
Alignment:
| Q |
301 |
ggaaaaggagagtacggtgagggatatggagaggcgtagttgg |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
139 |
ggaaaaggagagtacggtgagggatatggagaggcgtggttgg |
97 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 301 - 343
Target Start/End: Complemental strand, 53481365 - 53481323
Alignment:
| Q |
301 |
ggaaaaggagagtacggtgagggatatggagaggcgtagttgg |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53481365 |
ggaaaaggagagtacggtgagggatatggagaggcgtggttgg |
53481323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 260 - 333
Target Start/End: Complemental strand, 47746983 - 47746910
Alignment:
| Q |
260 |
ccgttacggatgaggtttcctcgtcttttttctttgacgttggaaaaggagagtacggtgagggatatggagag |
333 |
Q |
| |
|
||||| ||||||| ||||||||| | ||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47746983 |
ccgttgcggatgaagtttcctcgcttctttgattttgcgttggaaaaggagagtacggtgagggatatggagag |
47746910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University