View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1332_low_16 (Length: 340)
Name: NF1332_low_16
Description: NF1332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1332_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 101 - 325
Target Start/End: Original strand, 9569518 - 9569743
Alignment:
| Q |
101 |
ttgtgggaagagaatgtgtgctggcagagggttttgatggnnnnnnnnnnnnnnnnngtacgagtagcggacgataggtgtttagaacttgttttggtag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9569518 |
ttgtgggaagagaatgtgtgctggcagagggttttgatggttttttggagttttttggtacgagtagcggacgataggtgtttagaacttgttttggtag |
9569617 |
T |
 |
| Q |
201 |
ccatcaactagttgggtagtgtatttagtggtgttttgatgtaggagacgtaaca-gttttatgttggatatttcgcctgtatacgataccttttactgt |
299 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
9569618 |
ccatcaactagttgggtggtgtatttagtggtgttttgatgtaggagacgtaagaggttttatgttggatgtttcgcccgtatacgatgccttttactgt |
9569717 |
T |
 |
| Q |
300 |
gttctttctgttttactggtctatat |
325 |
Q |
| |
|
||||||||||||||||| |||||||| |
|
|
| T |
9569718 |
gttctttctgttttactagtctatat |
9569743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University