View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1332_low_24 (Length: 304)
Name: NF1332_low_24
Description: NF1332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1332_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 59 - 294
Target Start/End: Complemental strand, 25729228 - 25728999
Alignment:
| Q |
59 |
ctattagttaaacaaattagaggcctaaatattctttgaggccaaaagcggctactttatttatggnnnnnnnnnnnccttctagtaggatagatgttaa |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||| |
|
|
| T |
25729228 |
ctattagttaaacaaattagaggcctaaatattctttgaggccaaaagcggctactttatttatggttttttttt---cttccagaaggatagatgttaa |
25729132 |
T |
|
| Q |
159 |
tagttactacttattagattaatatttattcttttcgtccgaatttaatttcatggcttttaatttcttatcatttatctcaaatcagttgaactatcaa |
258 |
Q |
| |
|
||||||||||||| |||||||||||| | |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
25729131 |
tagttactactta---gattaatatttacttttttcgtccgaatttaatttcatgacttttaatctcttatcatttatctcaaatcagttgaactatcga |
25729035 |
T |
|
| Q |
259 |
acatcgttatttatggtcttctttgaccggcctttg |
294 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25729034 |
acatcgttatttatagtcttctttgaccggcctttg |
25728999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University