View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1332_low_37 (Length: 215)
Name: NF1332_low_37
Description: NF1332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1332_low_37 |
 |  |
|
| [»] scaffold0446 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 51 - 102
Target Start/End: Complemental strand, 10870054 - 10870003
Alignment:
| Q |
51 |
tatatattctttacctctcatgtcaagcataatctgattctaataaaatgta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10870054 |
tatatattctttacctctcatgtcaagcataatctgattctaataaaatgta |
10870003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 92 - 161
Target Start/End: Complemental strand, 27849452 - 27849383
Alignment:
| Q |
92 |
aataaaatgtaggtttaaactcactttttacctgttaagtttgtaaaaattgtaattttagcctcctatt |
161 |
Q |
| |
|
|||||| | |||| ||||||||||||||||||| ||||||||||||| ||| |||||||||| |||||| |
|
|
| T |
27849452 |
aataaagtataggcttaaactcactttttacctcctaagtttgtaaaagttgcaattttagccccctatt |
27849383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 106 - 150
Target Start/End: Original strand, 33075189 - 33075233
Alignment:
| Q |
106 |
ttaaactcactttttacctgttaagtttgtaaaaattgtaatttt |
150 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
33075189 |
ttaaacttactttttacctcctaagtttgtaaaagttgtaatttt |
33075233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0446 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0446
Description:
Target: scaffold0446; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 95 - 161
Target Start/End: Original strand, 11553 - 11619
Alignment:
| Q |
95 |
aaaatgtaggtttaaactcactttttacctgttaagtttgtaaaaattgtaattttagcctcctatt |
161 |
Q |
| |
|
|||| ||||| |||||||||||||||||| |||||||| |||| ||| |||||||||| |||||| |
|
|
| T |
11553 |
aaaaagtaggcttaaactcactttttaccccctaagtttgcaaaagttgcaattttagccccctatt |
11619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 95 - 161
Target Start/End: Original strand, 56112687 - 56112753
Alignment:
| Q |
95 |
aaaatgtaggtttaaactcactttttacctgttaagtttgtaaaaattgtaattttagcctcctatt |
161 |
Q |
| |
|
|||| ||||| |||||||||||||||||| |||||||| |||| ||| |||||||||| |||||| |
|
|
| T |
56112687 |
aaaaagtaggcttaaactcactttttaccccctaagtttgcaaaagttgcaattttagccccctatt |
56112753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University