View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1332_low_38 (Length: 214)

Name: NF1332_low_38
Description: NF1332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1332_low_38
NF1332_low_38
[»] chr7 (1 HSPs)
chr7 (52-136)||(31844081-31844165)


Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 52 - 136
Target Start/End: Original strand, 31844081 - 31844165
Alignment:
52 ttgataatttgaagttttgtagcaagcaagatggtcagagacatactaacctccgactcattctagaaaaatttactctctgctc 136  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||    
31844081 ttgataatttgaagctttgtagcaagcaagatggtcagagacatactaacccccgactcattctagaaaaatttactctttgctc 31844165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University