View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1332_low_39 (Length: 201)
Name: NF1332_low_39
Description: NF1332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1332_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 4 - 162
Target Start/End: Original strand, 5781888 - 5782046
Alignment:
| Q |
4 |
ggaggagcagagacttaagttagattcgagagtgaagatgacggagtcaggacttgtatcgccgccgccggtgacggtgttggcggtggtgttgcgtgtt |
103 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5781888 |
ggaggagaagagacttaagttagattcgagagtgaagatgacggagtcaggacttgtatcgccgccgccggtgacggtgttggcggtggtgttgcgtgtt |
5781987 |
T |
 |
| Q |
104 |
cttgaaccggtgttacgcctccacgaacgtcgttgttcgtgaaaccctaaatcccgcat |
162 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
5781988 |
cttgaaccggtgttacgcctccacgagcgtcgttgttcgtgaaaccctaaatcacgcat |
5782046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University