View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13330_high_9 (Length: 248)

Name: NF13330_high_9
Description: NF13330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13330_high_9
NF13330_high_9
[»] chr3 (14 HSPs)
chr3 (49-235)||(45604974-45605161)
chr3 (1-50)||(46352632-46352681)
chr3 (1-49)||(272219-272267)
chr3 (1-49)||(49893330-49893378)
chr3 (1-50)||(52520679-52520728)
chr3 (1-48)||(39074419-39074466)
chr3 (1-48)||(48725271-48725318)
chr3 (1-51)||(858586-858636)
chr3 (1-50)||(18014670-18014719)
chr3 (1-49)||(41304004-41304052)
chr3 (1-48)||(28139309-28139356)
chr3 (1-48)||(52246582-52246629)
chr3 (1-50)||(40362719-40362768)
chr3 (7-51)||(34300759-34300803)
[»] chr6 (16 HSPs)
chr6 (1-51)||(20897945-20897995)
chr6 (1-50)||(7851298-7851347)
chr6 (1-50)||(3515764-3515813)
chr6 (1-54)||(34396666-34396719)
chr6 (1-56)||(12145256-12145311)
chr6 (1-58)||(392086-392143)
chr6 (1-57)||(23402129-23402185)
chr6 (1-49)||(27433491-27433539)
chr6 (1-46)||(2350654-2350699)
chr6 (1-50)||(32929647-32929696)
chr6 (1-53)||(4215690-4215742)
chr6 (1-48)||(21878486-21878533)
chr6 (1-48)||(35043890-35043937)
chr6 (1-50)||(12525717-12525766)
chr6 (1-50)||(18276754-18276802)
chr6 (7-48)||(34712271-34712312)
[»] chr2 (20 HSPs)
chr2 (1-50)||(561657-561706)
chr2 (1-52)||(30486206-30486257)
chr2 (1-51)||(38591013-38591063)
chr2 (1-53)||(22068458-22068510)
chr2 (1-49)||(32361008-32361056)
chr2 (1-48)||(20552931-20552978)
chr2 (1-48)||(31438646-31438693)
chr2 (10-51)||(35851917-35851958)
chr2 (1-53)||(27856535-27856587)
chr2 (7-50)||(45261901-45261945)
chr2 (1-52)||(31390008-31390059)
chr2 (1-48)||(44587902-44587949)
chr2 (1-51)||(34442671-34442720)
chr2 (9-50)||(26154645-26154686)
chr2 (7-52)||(44854485-44854530)
chr2 (1-45)||(4381798-4381842)
chr2 (1-49)||(6580188-6580236)
chr2 (1-49)||(22887749-22887797)
chr2 (1-49)||(26891802-26891850)
chr2 (7-47)||(29771417-29771457)
[»] chr1 (27 HSPs)
chr1 (1-50)||(51065887-51065936)
chr1 (1-52)||(9266867-9266918)
chr1 (1-58)||(42770129-42770186)
chr1 (7-51)||(28726051-28726095)
chr1 (1-49)||(29657770-29657818)
chr1 (1-48)||(17333421-17333467)
chr1 (1-48)||(24178602-24178649)
chr1 (1-51)||(15227736-15227786)
chr1 (1-55)||(29683188-29683242)
chr1 (7-53)||(38595898-38595944)
chr1 (1-50)||(12072201-12072250)
chr1 (1-49)||(13961211-13961259)
chr1 (1-49)||(29210412-29210460)
chr1 (1-49)||(45431278-45431325)
chr1 (1-48)||(3784852-3784899)
chr1 (1-48)||(5694321-5694368)
chr1 (1-48)||(30294520-30294567)
chr1 (1-56)||(30657600-30657655)
chr1 (1-51)||(14350416-14350466)
chr1 (1-47)||(19011135-19011180)
chr1 (1-50)||(18043160-18043209)
chr1 (1-42)||(28725911-28725952)
chr1 (1-46)||(38702072-38702117)
chr1 (1-50)||(43286720-43286769)
chr1 (1-50)||(51368924-51368973)
chr1 (7-48)||(52702291-52702332)
chr1 (1-45)||(48383250-48383294)
[»] chr7 (17 HSPs)
chr7 (1-57)||(34333275-34333331)
chr7 (6-51)||(18485958-18486003)
chr7 (1-57)||(12218575-12218631)
chr7 (7-51)||(32805535-32805579)
chr7 (1-52)||(5729342-5729393)
chr7 (7-52)||(6097332-6097377)
chr7 (7-52)||(20402385-20402430)
chr7 (1-50)||(29993626-29993675)
chr7 (1-58)||(47839483-47839539)
chr7 (1-57)||(4628557-4628613)
chr7 (1-48)||(24438477-24438524)
chr7 (1-52)||(24798542-24798592)
chr7 (1-48)||(34606261-34606308)
chr7 (1-48)||(43594175-43594222)
chr7 (1-47)||(28587911-28587956)
chr7 (1-53)||(8754724-8754776)
chr7 (5-49)||(27456256-27456299)
[»] chr5 (12 HSPs)
chr5 (1-53)||(8787334-8787386)
chr5 (1-48)||(10069969-10070016)
chr5 (1-51)||(10054491-10054541)
chr5 (1-50)||(13661806-13661855)
chr5 (1-50)||(35132520-35132569)
chr5 (1-58)||(39069371-39069428)
chr5 (1-50)||(19647797-19647846)
chr5 (7-50)||(21945006-21945049)
chr5 (1-48)||(34650972-34651018)
chr5 (1-48)||(35504379-35504426)
chr5 (1-50)||(13470149-13470198)
chr5 (7-52)||(16972172-16972217)
[»] chr4 (26 HSPs)
chr4 (1-48)||(28755621-28755667)
chr4 (1-50)||(15186241-15186290)
chr4 (1-49)||(4268961-4269009)
chr4 (1-49)||(18068018-18068066)
chr4 (1-53)||(46688349-46688401)
chr4 (4-48)||(54897308-54897352)
chr4 (1-49)||(55882683-55882731)
chr4 (1-52)||(43944503-43944554)
chr4 (1-51)||(43202522-43202572)
chr4 (1-50)||(789669-789718)
chr4 (1-50)||(47232011-47232060)
chr4 (7-51)||(11893547-11893591)
chr4 (1-49)||(50167590-50167638)
chr4 (1-48)||(24679781-24679827)
chr4 (3-50)||(29591187-29591234)
chr4 (1-48)||(32202619-32202666)
chr4 (1-48)||(32217045-32217092)
chr4 (1-48)||(54054548-54054595)
chr4 (1-51)||(16536045-16536095)
chr4 (1-50)||(7768936-7768985)
chr4 (1-50)||(8133732-8133780)
chr4 (1-50)||(52533924-52533973)
chr4 (7-51)||(292111-292155)
chr4 (1-49)||(4089141-4089189)
chr4 (1-53)||(19503244-19503295)
chr4 (9-45)||(25532957-25532993)
[»] scaffold0014 (1 HSPs)
scaffold0014 (1-51)||(68429-68479)
[»] chr8 (24 HSPs)
chr8 (1-51)||(16785084-16785133)
chr8 (1-50)||(27988638-27988687)
chr8 (1-50)||(28045940-28045989)
chr8 (1-53)||(9063191-9063242)
chr8 (1-53)||(16394200-16394252)
chr8 (1-57)||(33357268-33357324)
chr8 (1-48)||(30675711-30675758)
chr8 (1-48)||(34228682-34228729)
chr8 (1-51)||(4648192-4648241)
chr8 (1-50)||(168464-168513)
chr8 (6-51)||(4537888-4537933)
chr8 (1-50)||(13643010-13643059)
chr8 (1-50)||(13743435-13743484)
chr8 (1-46)||(20831692-20831737)
chr8 (7-48)||(39751617-39751658)
chr8 (1-48)||(12652630-12652677)
chr8 (1-48)||(37373206-37373252)
chr8 (1-51)||(10618015-10618065)
chr8 (1-47)||(16888683-16888728)
chr8 (1-47)||(21595848-21595893)
chr8 (1-54)||(2805399-2805452)
chr8 (7-48)||(29566700-29566741)
chr8 (7-51)||(2490334-2490378)
chr8 (1-49)||(43119216-43119264)
[»] scaffold0264 (1 HSPs)
scaffold0264 (1-50)||(22959-23008)
[»] scaffold0003 (1 HSPs)
scaffold0003 (1-49)||(53824-53872)
[»] scaffold0190 (1 HSPs)
scaffold0190 (1-48)||(14896-14943)
[»] scaffold0188 (1 HSPs)
scaffold0188 (1-47)||(6249-6295)
[»] scaffold1266 (1 HSPs)
scaffold1266 (1-49)||(292-339)
[»] scaffold0021 (1 HSPs)
scaffold0021 (1-51)||(116201-116251)
[»] scaffold0045 (1 HSPs)
scaffold0045 (1-58)||(50538-50595)
[»] scaffold1152 (1 HSPs)
scaffold1152 (1-49)||(677-725)


Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 14)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 49 - 235
Target Start/End: Original strand, 45604974 - 45605161
Alignment:
Q  49 ttatattaaacgtattcacaataatatgcctctat-taattttggtgtcatatattattagaatgtagacatttgtattttatattcctttacaaactac 147  Q
    |||||||||||||||||||||||| |||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45604974 ttatattaaacgtattcacaataacatgcctctatattaatttggtgtcatatattattagaatgtagacatttgtattttatattcctttacaaactac 45605073  T
Q  148 aagtttatttaaagcaaatgatattgctatttgctacctaggtcgatgaccacaaatttaagctatatactacctaattttatgtgat 235  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45605074 aagtttatttaaagcaaatgatattgctatttgctacctaggtcgatgaccacaaatttaagctatatactacctaattttatgtgat 45605161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 46352681 - 46352632
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||||||||||||||||||||| |||| ||||||||||||||||||||    
T  46352681 ttttcatatccttaaccagtgccccgggggcaccggttagcatttccctt 46352632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 272267 - 272219
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||||||||||||||||||||||| |||| |||||||||||||||||||    
T  272267 ttttcatatccttaaccagtgccccgggggcaccggttagcatttccct 272219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 49893378 - 49893330
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||||||||||||||||||||||| |||| |||||||||||||||||||    
T  49893378 ttttcatatccttaaccagtgccccgggggcaccggttagcatttccct 49893330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 52520728 - 52520679
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||||| ||||||||||||||| |||| ||||||||||||||||||||    
T  52520728 ttttcatacccttaaccagtgccccgggggcaccggttagcatttccctt 52520679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 39074466 - 39074419
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||||||| ||||||||||||||| |||| ||||||||||||||||||    
T  39074466 ttttcatacccttaaccagtgccccgggggcaccggttagcatttccc 39074419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 48725318 - 48725271
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    ||||||||||||||||||||||||  ||| ||||||||||||||||||    
T  48725318 ttttcatatccttaaccagtgcccccggggcaccggttagcatttccc 48725271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 858636 - 858586
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    |||||||||||||||| ||||| |||||| |||||||| ||||||||||||    
T  858636 ttttcatatccttaactagtgcactgggggcaccggtttgcatttccctta 858586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 18014719 - 18014670
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    ||||||||||||||| |||||||| |||| |||| |||||||||||||||    
T  18014719 ttttcatatccttaatcagtgccccgggggcaccagttagcatttccctt 18014670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 41304052 - 41304004
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||||||||||||||||| ||||| || | |||||||||||||||||||    
T  41304052 ttttcatatccttaaccactgccccggaggcaccggttagcatttccct 41304004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 28139356 - 28139309
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    ||||||||||||||||||||| | ||||| |||| |||||||||||||    
T  28139356 ttttcatatccttaaccagtgtcttgggggcaccagttagcatttccc 28139309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 52246629 - 52246582
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||||||||||||||||||||||| || | |||| |||||||||||||    
T  52246629 ttttcatatccttaaccagtgccccggaggcaccagttagcatttccc 52246582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 40362719 - 40362768
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    ||||||||||||||| |||||||| || | ||| ||||||||||||||||    
T  40362719 ttttcatatccttaatcagtgccccggaggcacgggttagcatttccctt 40362768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 51
Target Start/End: Original strand, 34300759 - 34300803
Alignment:
Q  7 tatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    ||||||||||||||||| ||| |||| |||||| |||||||||||    
T  34300759 tatccttaaccagtgccttggagacatcggttaacatttccctta 34300803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 47; Significance: 6e-18; HSPs: 16)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 20897995 - 20897945
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  20897995 ttttcatatccttaaccagtgccctgggggcaccggttagcatttccctta 20897945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 7851298 - 7851347
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  7851298 ttttcatatccttaaccagtgccctgggggcaccggttagcatttccctt 7851347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 3515813 - 3515764
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||||| |||||||||||||||||||| ||||||||||||||||||||    
T  3515813 ttttcatacccttaaccagtgccctgggggcaccggttagcatttccctt 3515764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 34396666 - 34396719
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttatat 54  Q
    ||||||||||||||||| ||| ||||||| ||||||||||||||||||||||||    
T  34396666 ttttcatatccttaacctgtgtcctgggggcaccggttagcatttcccttatat 34396719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 12145256 - 12145311
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttatatta 56  Q
    |||||||||||||||| ||||| |||||| |||||||||||||||||| |||||||    
T  12145256 ttttcatatccttaacaagtgcactgggggcaccggttagcatttcccatatatta 12145311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 392143 - 392086
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttatattaaa 58  Q
    |||||||| ||||||||||||||| |||| |||||||||||||||||| || ||||||    
T  392143 ttttcatacccttaaccagtgccccgggggcaccggttagcatttcccataaattaaa 392086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 23402185 - 23402129
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttatattaa 57  Q
    |||||||||||||||||||||||| || | |||| ||||||||||||||||| ||||    
T  23402185 ttttcatatccttaaccagtgccccggaggcaccagttagcatttcccttattttaa 23402129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 27433539 - 27433491
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||||||| ||||||||||||||| |||| |||||||||||||||||||    
T  27433539 ttttcatacccttaaccagtgccccgggggcaccggttagcatttccct 27433491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 2350699 - 2350654
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttc 46  Q
    |||||||||||||||||||||||| |||  ||||||||||||||||    
T  2350699 ttttcatatccttaaccagtgccccgggagcaccggttagcatttc 2350654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 32929647 - 32929696
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||||| ||||||||| ||||| |||| ||||||||||||||||||||    
T  32929647 ttttcatacccttaaccattgccccgggggcaccggttagcatttccctt 32929696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 4215742 - 4215690
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttata 53  Q
    ||||||||  |||||||||||||| |||| ||||||||| |||||||||||||    
T  4215742 ttttcatactcttaaccagtgccccgggggcaccggttaacatttcccttata 4215690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 21878486 - 21878533
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    ||||||||||||||||| |||||| || | ||||||||||||||||||    
T  21878486 ttttcatatccttaacccgtgcccgggaggcaccggttagcatttccc 21878533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 35043937 - 35043890
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    ||||||||||||||||||||| || | ||||||| |||||||||||||    
T  35043937 ttttcatatccttaaccagtgtcccgtggacaccagttagcatttccc 35043890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 12525766 - 12525717
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||||| ||||||||||| ||| || | ||||||||||||||||||||    
T  12525766 ttttcatacccttaaccagtaccccggaggcaccggttagcatttccctt 12525717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 18276754 - 18276802
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||||||||||||||||||||| |||| |||| |||| ||||||||||    
T  18276754 ttttcatatccttaaccagtgcccagggg-caccagttaacatttccctt 18276802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 48
Target Start/End: Original strand, 34712271 - 34712312
Alignment:
Q  7 tatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||||||||||||||||| || | ||||||||||||||||||    
T  34712271 tatccttaaccagtgccccggaggcaccggttagcatttccc 34712312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 20)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 561657 - 561706
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||||||||||||||||||||| |||| ||||||||||||||||||||    
T  561657 ttttcatatccttaaccagtgccccgggggcaccggttagcatttccctt 561706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 30486257 - 30486206
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttat 52  Q
    |||||||||||||||||||||||| |||| |||| |||||||||||||||||    
T  30486257 ttttcatatccttaaccagtgccccgggggcaccagttagcatttcccttat 30486206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 38591013 - 38591063
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    ||||||||| ||||||||||||||  |||||||||||||||||||||||||    
T  38591013 ttttcatattcttaaccagtgccccagggacaccggttagcatttccctta 38591063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 22068458 - 22068510
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttata 53  Q
    |||||||||||||||||||||||| |||| |||  ||||||||||||||||||    
T  22068458 ttttcatatccttaaccagtgccccgggggcacttgttagcatttcccttata 22068510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 32361008 - 32361056
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||||| ||||||||||||||||| |||| |||||||||||||||||||    
T  32361008 ttttcacatccttaaccagtgccccgggggcaccggttagcatttccct 32361056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 20552978 - 20552931
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    ||||||||||||||||||||||||  ||| ||||||||||||||||||    
T  20552978 ttttcatatccttaaccagtgcccccggggcaccggttagcatttccc 20552931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 31438693 - 31438646
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||||||||||||||||||||||| |||  ||||||||||||||||||    
T  31438693 ttttcatatccttaaccagtgccccgggagcaccggttagcatttccc 31438646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 10 - 51
Target Start/End: Original strand, 35851917 - 35851958
Alignment:
Q  10 ccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    ||||||||||||||| |||| |||||||||||||||||||||    
T  35851917 ccttaaccagtgccccgggggcaccggttagcatttccctta 35851958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 27856535 - 27856587
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttata 53  Q
    ||||||||  |||||||||||||| |||| ||||||||| |||||||||||||    
T  27856535 ttttcatactcttaaccagtgccccgggggcaccggttaacatttcccttata 27856587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 50
Target Start/End: Complemental strand, 45261945 - 45261901
Alignment:
Q  7 tatccttaaccagtgccct-ggggacaccggttagcatttccctt 50  Q
    ||||||||||||||||||| |||| ||||||||||||||||||||    
T  45261945 tatccttaaccagtgccctggggggcaccggttagcatttccctt 45261901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 31390059 - 31390008
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttat 52  Q
    |||||||||||||||| ||||||| || | |||| |||||||||||||||||    
T  31390059 ttttcatatccttaactagtgccccggaggcaccagttagcatttcccttat 31390008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 44587949 - 44587902
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||| |||||||||||| |||||| |||| ||||||||||||||||||    
T  44587949 tttttatatccttaaccggtgccccgggggcaccggttagcatttccc 44587902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 34442671 - 34442720
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    ||||||||||||||||  |||||| |||| |||||||||||||||||||||    
T  34442671 ttttcatatccttaacatgtgccccgggg-caccggttagcatttccctta 34442720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 50
Target Start/End: Original strand, 26154645 - 26154686
Alignment:
Q  9 tccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    ||||||||||||||||||||||||| || ||||||| |||||    
T  26154645 tccttaaccagtgccctggggacactggatagcattgccctt 26154686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 44854485 - 44854530
Alignment:
Q  7 tatccttaaccagtgccctggggacaccggttagcatttcccttat 52  Q
    |||||||||||||||||| |||   |||||||||||||||||||||    
T  44854485 tatccttaaccagtgccccgggagtaccggttagcatttcccttat 44854530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 4381842 - 4381798
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcattt 45  Q
    |||||||| ||||||||||||| | |||| |||||||||||||||    
T  4381842 ttttcatacccttaaccagtgcaccgggggcaccggttagcattt 4381798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 6580236 - 6580188
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||||||| |||||||||||||||  ||| ||| |||||||||||||||    
T  6580236 ttttcatacccttaaccagtgcccccggggcactggttagcatttccct 6580188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 22887797 - 22887749
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||||||||||||||||| ||||| || | || ||||||||||||||||    
T  22887797 ttttcatatccttaaccactgccccggaggcatcggttagcatttccct 22887749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 26891802 - 26891850
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||| |||||||||| ||||| || |||| |||||||||||||||||||    
T  26891802 tttttatatccttaatcagtgtcccgggggcaccggttagcatttccct 26891850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 47
Target Start/End: Complemental strand, 29771457 - 29771417
Alignment:
Q  7 tatccttaaccagtgccctggggacaccggttagcatttcc 47  Q
    |||||||||||||||||| |||| || ||||||||||||||    
T  29771457 tatccttaaccagtgccccgggggcatcggttagcatttcc 29771417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 27)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 51065887 - 51065936
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    ||||||||||||||||||||| || |||||||||||||||||||||||||    
T  51065887 ttttcatatccttaaccagtgtcccggggacaccggttagcatttccctt 51065936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 9266867 - 9266918
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttat 52  Q
    |||||||||||||||||||||||  |||||||||||||| ||||||||||||    
T  9266867 ttttcatatccttaaccagtgccgcggggacaccggttaacatttcccttat 9266918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 42770129 - 42770186
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttatattaaa 58  Q
    |||||||| | ||||||||||||| |||| ||||||||||||||||||||| ||||||    
T  42770129 ttttcataccattaaccagtgccccgggggcaccggttagcatttcccttaaattaaa 42770186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 51
Target Start/End: Original strand, 28726051 - 28726095
Alignment:
Q  7 tatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    |||||||||||||||||| |||| |||||||||||||||||||||    
T  28726051 tatccttaaccagtgccccgggggcaccggttagcatttccctta 28726095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 29657818 - 29657770
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||| ||||||||||||||||||| |||| |||||||||||||||||||    
T  29657818 tttttatatccttaaccagtgccccgggggcaccggttagcatttccct 29657770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 17333421 - 17333467
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||||||||||||||||||||||| |||| ||||||||||||||||||    
T  17333421 ttttcatatccttaaccagtgccc-gggggcaccggttagcatttccc 17333467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 24178602 - 24178649
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||||||||||||||||||||||| |||| || |||||||||||||||    
T  24178602 ttttcatatccttaaccagtgccccgggggcatcggttagcatttccc 24178649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 15227786 - 15227736
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    ||||||||||||||||||||||||  |||  ||||||||||||||||||||    
T  15227786 ttttcatatccttaaccagtgcccccggggtaccggttagcatttccctta 15227736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 29683242 - 29683188
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttatatt 55  Q
    |||| ||||| ||||||||||||| |||| |||||||||||||||||||| ||||    
T  29683242 tttttatatctttaaccagtgccccgggggcaccggttagcatttcccttgtatt 29683188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 7 - 53
Target Start/End: Original strand, 38595898 - 38595944
Alignment:
Q  7 tatccttaaccagtgccctggggacaccggttagcatttcccttata 53  Q
    |||||||||||||||||| |||| |||||||||||||||||| ||||    
T  38595898 tatccttaaccagtgccccgggggcaccggttagcatttcccatata 38595944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 12072201 - 12072250
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    ||||||||||||||||| |||||| |||| ||||||||||||||| ||||    
T  12072201 ttttcatatccttaaccggtgccccgggggcaccggttagcattttcctt 12072250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 13961259 - 13961211
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||| |||||||||||| |||||| |||| |||||||||||||||||||    
T  13961259 tttttatatccttaacccgtgccccgggggcaccggttagcatttccct 13961211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 29210460 - 29210412
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||||||| ||||||||||||||| || | |||||||||||||||||||    
T  29210460 ttttcatacccttaaccagtgccccggaggcaccggttagcatttccct 29210412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 45431325 - 45431278
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    ||||||||||||||| ||| ||||||||| |||||||||||||||||||    
T  45431325 ttttcatatccttaatcag-gccctgggggcaccggttagcatttccct 45431278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 3784852 - 3784899
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||||||||||||||||||||| |||||| ||||| || |||||||||    
T  3784852 ttttcatatccttaaccagtgcactgggggcaccgatttgcatttccc 3784899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 5694368 - 5694321
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||| ||||||||||||||||||| || | ||||||||||||||||||    
T  5694368 tttttatatccttaaccagtgccccggaggcaccggttagcatttccc 5694321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 30294520 - 30294567
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||||||||||||||||| ||| | |||||||||| ||||||||||||    
T  30294520 ttttcatatccttaaccaatgctccggggacaccgattagcatttccc 30294567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 30657655 - 30657600
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttatatta 56  Q
    ||||||||| |||||| ||||||| |||  |||||||||||||||||||| |||||    
T  30657655 ttttcatatgcttaactagtgccccgggagcaccggttagcatttcccttttatta 30657600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 14350416 - 14350466
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    |||||||| |||||||| |||| | |||| |||||||||||||||||||||    
T  14350416 ttttcatacccttaaccggtgctccgggggcaccggttagcatttccctta 14350466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 19011135 - 19011180
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcc 47  Q
    ||||||||||||||||| |||||| ||| ||||||||||||||||||    
T  19011135 ttttcatatccttaacccgtgccccggg-acaccggttagcatttcc 19011180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 18043209 - 18043160
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||| ||| ||||||||||||||| || | ||||||||||||||||||||    
T  18043209 tttttatacccttaaccagtgccccggaggcaccggttagcatttccctt 18043160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 28725952 - 28725911
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagca 42  Q
    ||||| ||| |||||||||||||| |||||||||||||||||    
T  28725952 ttttcgtatgcttaaccagtgccccggggacaccggttagca 28725911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 38702072 - 38702117
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttc 46  Q
    |||||||| ||||||||||||||| |||  ||||||||||||||||    
T  38702072 ttttcatacccttaaccagtgccccgggagcaccggttagcatttc 38702117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 43286769 - 43286720
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    ||||||||||||||||||||| ||  |||||| |||||||||||| ||||    
T  43286769 ttttcatatccttaaccagtgtcccagggacatcggttagcattttcctt 43286720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 51368924 - 51368973
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||||| ||||||||||| |||||| |  |||||||||||||||||||    
T  51368924 ttttcatacccttaaccagtaccctggaggtaccggttagcatttccctt 51368973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 48
Target Start/End: Original strand, 52702291 - 52702332
Alignment:
Q  7 tatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||||||||||||||||| |||  ||||||||||||||||||    
T  52702291 tatccttaaccagtgccccgggagcaccggttagcatttccc 52702332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 48383250 - 48383294
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcattt 45  Q
    |||||| ||||||||||||||||| |||  |||||||||||||||    
T  48383250 ttttcacatccttaaccagtgccccgggagcaccggttagcattt 48383294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 17)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 34333331 - 34333275
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttatattaa 57  Q
    |||||||| ||||||||||||||| |||| |||||||||||||||||||||| ||||    
T  34333331 ttttcatacccttaaccagtgccccgggggcaccggttagcatttcccttattttaa 34333275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 6 - 51
Target Start/End: Complemental strand, 18486003 - 18485958
Alignment:
Q  6 atatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    ||||||||||||||||||| |||| |||||||||||||||||||||    
T  18486003 atatccttaaccagtgccccgggggcaccggttagcatttccctta 18485958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 12218575 - 12218631
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttatattaa 57  Q
    ||||||||| |||| ||||||||| |||| ||||||||||||||||||||| |||||    
T  12218575 ttttcatatacttatccagtgccccgggggcaccggttagcatttcccttaaattaa 12218631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 51
Target Start/End: Complemental strand, 32805579 - 32805535
Alignment:
Q  7 tatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    |||||||||||||||||| ||| ||||||||||||||||||||||    
T  32805579 tatccttaaccagtgccccgggaacaccggttagcatttccctta 32805535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 5729393 - 5729342
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttat 52  Q
    |||||||||||||||||||||| | ||| |||||||||| ||||||||||||    
T  5729393 ttttcatatccttaaccagtgctccgggaacaccggttaacatttcccttat 5729342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 6097377 - 6097332
Alignment:
Q  7 tatccttaaccagtgccctggggacaccggttagcatttcccttat 52  Q
    |||||||||||||||||| |||| || |||||||||||||||||||    
T  6097377 tatccttaaccagtgccccgggggcatcggttagcatttcccttat 6097332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 20402430 - 20402385
Alignment:
Q  7 tatccttaaccagtgccctggggacaccggttagcatttcccttat 52  Q
    |||||||||||| || || |||||||||||||||||||||||||||    
T  20402430 tatccttaaccaatgtcccggggacaccggttagcatttcccttat 20402385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 29993626 - 29993675
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    ||||||||||||||||| |||||| |||| |||| |||||||||||||||    
T  29993626 ttttcatatccttaaccggtgccccgggggcacccgttagcatttccctt 29993675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 47839539 - 47839483
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttatattaaa 58  Q
    |||||||||||||||||||| ||| ||| |||||||||||||||||||| || |||||    
T  47839539 ttttcatatccttaaccagtaccccggg-acaccggttagcatttccctaattttaaa 47839483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 4628613 - 4628557
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttatattaa 57  Q
    ||||||||||||||||| ||||||  ||| || ||||||||||||||||| ||||||    
T  4628613 ttttcatatccttaaccggtgccccaggggcatcggttagcatttcccttttattaa 4628557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 24438524 - 24438477
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||||||| ||||||| ||||||| |||| ||||||||||||||||||    
T  24438524 ttttcatacccttaactagtgccccgggggcaccggttagcatttccc 24438477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 24798542 - 24798592
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttat 52  Q
    |||||||||||| ||| ||||||| |||| ||||||||||||||||||||||    
T  24798542 ttttcatatcctcaacaagtgcccggggg-caccggttagcatttcccttat 24798592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 34606308 - 34606261
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||||||||||||||||||||||| || | |||| |||||||||||||    
T  34606308 ttttcatatccttaaccagtgccccggaggcaccagttagcatttccc 34606261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 43594175 - 43594222
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||| ||||||||||||||||  | |||||||||||||||||||||||    
T  43594175 tttttatatccttaaccagtgttccggggacaccggttagcatttccc 43594222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 28587956 - 28587911
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcc 47  Q
    ||||||||||||||||||||| || |||| |||||||||||||||||    
T  28587956 ttttcatatccttaaccagtgtcc-gggggcaccggttagcatttcc 28587911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 8754724 - 8754776
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttata 53  Q
    |||||||||||||||||||||| |   || |||||||||||||||||| ||||    
T  8754724 ttttcatatccttaaccagtgctcccagggcaccggttagcatttcccatata 8754776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 27456256 - 27456299
Alignment:
Q  5 catatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||||||||||||||||||| |||| |||| ||||||||||||||    
T  27456256 catatccttaaccagtgccc-gggggcaccagttagcatttccct 27456299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 12)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 8787386 - 8787334
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttata 53  Q
    |||||||| ||||||||| ||||| ||||||||||||||||||||||||||||    
T  8787386 ttttcatacccttaaccaatgccccggggacaccggttagcatttcccttata 8787334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 10070016 - 10069969
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||||||||||||||||||||||| |||| ||||||||||||||||||    
T  10070016 ttttcatatccttaaccagtgccccgggggcaccggttagcatttccc 10069969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 10054491 - 10054541
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    |||||||| ||||||||||||||| |||| |||||||||||||||||||||    
T  10054491 ttttcatacccttaaccagtgccccgggggcaccggttagcatttccctta 10054541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 13661855 - 13661806
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||||||||||||||||||| | |||| ||||||||||||||||||||    
T  13661855 ttttcatatccttaaccagtgctccgggggcaccggttagcatttccctt 13661806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 35132569 - 35132520
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    ||||||||||||||||||||| || |||| ||||||||||||||||||||    
T  35132569 ttttcatatccttaaccagtgtcccgggggcaccggttagcatttccctt 35132520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 39069428 - 39069371
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttatattaaa 58  Q
    |||||||| ||||||||||||||||||   ||||||||||||||||||||| ||||||    
T  39069428 ttttcatacccttaaccagtgccctggaagcaccggttagcatttcccttaaattaaa 39069371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 19647797 - 19647846
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||||||||||||||||||||| || || |||||||||||||| ||||    
T  19647797 ttttcatatccttaaccagtgccccggagataccggttagcattttcctt 19647846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 50
Target Start/End: Original strand, 21945006 - 21945049
Alignment:
Q  7 tatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||||||||||||||| || | ||||||||||||||||||||    
T  21945006 tatccttaaccagtgccccggaggcaccggttagcatttccctt 21945049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 34650972 - 34651018
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||||||| ||||||||||||||| |||| ||||||||||||||||||    
T  34650972 ttttcatacccttaaccagtgccc-gggggcaccggttagcatttccc 34651018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 35504379 - 35504426
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||||||| |||||||||||| || |||| ||||||||||||||||||    
T  35504379 ttttcatacccttaaccagtgtcccgggggcaccggttagcatttccc 35504426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 13470198 - 13470149
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    ||||||||||||||||||||||||    | ||||||||||||||||||||    
T  13470198 ttttcatatccttaaccagtgccccataggcaccggttagcatttccctt 13470149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 16972217 - 16972172
Alignment:
Q  7 tatccttaaccagtgccctggggacaccggttagcatttcccttat 52  Q
    |||||||||||||||| | |||| || |||||||||||||||||||    
T  16972217 tatccttaaccagtgctccgggggcatcggttagcatttcccttat 16972172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 26)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 28755667 - 28755621
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||    
T  28755667 ttttcatatccttaaccagtgccct-gggacaccggttagcatttccc 28755621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 15186290 - 15186241
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||||| ||||||||||||||| |||| ||||||||||||||||||||    
T  15186290 ttttcatacccttaaccagtgccccgggggcaccggttagcatttccctt 15186241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 4268961 - 4269009
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||||||| ||||||||||||||| |||| |||||||||||||||||||    
T  4268961 ttttcatacccttaaccagtgccccgggggcaccggttagcatttccct 4269009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 18068018 - 18068066
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||||||| ||||||||||||||| |||| |||||||||||||||||||    
T  18068018 ttttcatacccttaaccagtgccccgggggcaccggttagcatttccct 18068066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 46688349 - 46688401
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttata 53  Q
    |||||||||||||||||||||||  |||| |||| ||||||||||||||||||    
T  46688349 ttttcatatccttaaccagtgcctcgggggcaccagttagcatttcccttata 46688401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 54897352 - 54897308
Alignment:
Q  4 tcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    ||||||||||||||||||||| |||| ||||||||||||||||||    
T  54897352 tcatatccttaaccagtgccccgggggcaccggttagcatttccc 54897308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 55882731 - 55882683
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||||||||||||||| ||||||| || |||||||||||||||||||||    
T  55882731 ttttcatatccttaacgagtgccccggagacaccggttagcatttccct 55882683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 43944554 - 43944503
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttat 52  Q
    |||||||| ||||||||||||||| || | ||||||||||||||||||||||    
T  43944554 ttttcatacccttaaccagtgccccggaggcaccggttagcatttcccttat 43944503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 43202522 - 43202572
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    |||||||| ||||||| ||||||| |||| |||||||||||||||||||||    
T  43202522 ttttcatacccttaactagtgccccgggggcaccggttagcatttccctta 43202572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 789669 - 789718
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||||| |||||||| |||||| |||| ||||||||||||||||||||    
T  789669 ttttcatacccttaacccgtgccccgggggcaccggttagcatttccctt 789718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 47232011 - 47232060
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||| ||||||||||||||| | |||| ||||||||||||||||||||    
T  47232011 ttttcacatccttaaccagtgctccgggggcaccggttagcatttccctt 47232060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 51
Target Start/End: Original strand, 11893547 - 11893591
Alignment:
Q  7 tatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    ||||||||| ||||||||||||| |||| ||||||||||||||||    
T  11893547 tatccttaaacagtgccctgggggcacctgttagcatttccctta 11893591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 50167638 - 50167590
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||||||||| ||||||||||||| | | ||||||||||||||||||||    
T  50167638 ttttcatatctttaaccagtgccccgagaacaccggttagcatttccct 50167590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 24679781 - 24679827
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    ||||||||||||||||||||||||  | ||||||||||||||||||||    
T  24679781 ttttcatatccttaaccagtgccc-cgagacaccggttagcatttccc 24679827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 3 - 50
Target Start/End: Complemental strand, 29591234 - 29591187
Alignment:
Q  3 ttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    ||||||| |||||||||||||| |||| |||| |||||||||||||||    
T  29591234 ttcatattcttaaccagtgccccgggggcaccagttagcatttccctt 29591187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 32202619 - 32202666
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||| |||||||||||| |||||| |||||||||||||| ||||||||    
T  32202619 tttttatatccttaacccgtgccccggggacaccggttaacatttccc 32202666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 32217092 - 32217045
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||| ||||||||||||||||||| |||| |||| |||||||||||||    
T  32217092 tttttatatccttaaccagtgccccgggggcaccagttagcatttccc 32217045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 54054595 - 54054548
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    ||||||||||||||||| ||||||  ||| ||||||||||||||||||    
T  54054595 ttttcatatccttaaccggtgcccccggggcaccggttagcatttccc 54054548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 16536095 - 16536045
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    |||||||| |||||| | |||||| |||| |||||||||||||||||||||    
T  16536095 ttttcatacccttaatccgtgccccgggggcaccggttagcatttccctta 16536045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 7768985 - 7768936
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||||| ||||||||||||||| ||||  |||| ||||||||||||||    
T  7768985 ttttcatacccttaaccagtgccccgggggtaccgattagcatttccctt 7768936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 8133780 - 8133732
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    ||||||||||||||||||||| || ||| | |||||||||||||||||||    
T  8133780 ttttcatatccttaaccagtgtcc-gggaagaccggttagcatttccctt 8133732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 52533924 - 52533973
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    ||||||||| ||||||||||| ||||| | ||||||||| ||||||||||    
T  52533924 ttttcatattcttaaccagtgtcctggaggcaccggttaacatttccctt 52533973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 51
Target Start/End: Complemental strand, 292155 - 292111
Alignment:
Q  7 tatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    ||||||||||| ||||||  ||| |||||||||||||||||||||    
T  292155 tatccttaaccggtgcccccggggcaccggttagcatttccctta 292111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 4089189 - 4089141
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||||||| |||||| ||||||||  ||| |||||||||||||||||||    
T  4089189 ttttcatacccttaatcagtgccccaggggcaccggttagcatttccct 4089141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 19503244 - 19503295
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttata 53  Q
    |||||||||||||||||||| ||| |||  ||||||||||||||||| |||||    
T  19503244 ttttcatatccttaaccagtaccc-gggagcaccggttagcatttccattata 19503295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 45
Target Start/End: Complemental strand, 25532993 - 25532957
Alignment:
Q  9 tccttaaccagtgccctggggacaccggttagcattt 45  Q
    ||||||||||||||||||||| ||||||||| |||||    
T  25532993 tccttaaccagtgccctgggggcaccggttaacattt 25532957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0014
Description:

Target: scaffold0014; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 68429 - 68479
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    |||||||||||||||||||||||| |||| |||| ||||||||||||||||    
T  68429 ttttcatatccttaaccagtgccccgggggcaccagttagcatttccctta 68479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 24)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 16785133 - 16785084
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    ||||||||||||||||||||||||||| | |||||||||||||||||||||    
T  16785133 ttttcatatccttaaccagtgccctggag-caccggttagcatttccctta 16785084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 27988638 - 27988687
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||||||||||||||||||||| || | ||||||||||||||||||||    
T  27988638 ttttcatatccttaaccagtgccccggaggcaccggttagcatttccctt 27988687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 28045940 - 28045989
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||||||||||||||||||||| || | ||||||||||||||||||||    
T  28045940 ttttcatatccttaaccagtgccccggaggcaccggttagcatttccctt 28045989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 9063191 - 9063242
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttata 53  Q
    |||||||||||||||||||||| | ||| ||||||||||||||||||||||||    
T  9063191 ttttcatatccttaaccagtgctccggg-acaccggttagcatttcccttata 9063242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 16394200 - 16394252
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttata 53  Q
    |||||| ||||||||||||||||| |||| |||||||||||||||||| ||||    
T  16394200 ttttcacatccttaaccagtgccccgggggcaccggttagcatttcccatata 16394252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 33357268 - 33357324
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttatattaa 57  Q
    |||||||||||||||||||||| | |||| |||| ||||||||||||||||| ||||    
T  33357268 ttttcatatccttaaccagtgctccgggggcaccagttagcatttcccttattttaa 33357324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 30675711 - 30675758
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||||||| ||||||||||||||| |||| ||||||||||||||||||    
T  30675711 ttttcatacccttaaccagtgccccgggggcaccggttagcatttccc 30675758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 34228729 - 34228682
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    ||||||||||||||||||||||||  ||| ||||||||||||||||||    
T  34228729 ttttcatatccttaaccagtgcccccggggcaccggttagcatttccc 34228682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 4648241 - 4648192
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    ||||||||||||||| |||||||| ||| ||||||||||||||||||||||    
T  4648241 ttttcatatccttaatcagtgccccggg-acaccggttagcatttccctta 4648192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 168513 - 168464
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||||| ||||||||||||||| || | ||||||||||||||||||||    
T  168513 ttttcatacccttaaccagtgccccggaggcaccggttagcatttccctt 168464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 6 - 51
Target Start/End: Original strand, 4537888 - 4537933
Alignment:
Q  6 atatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    ||||||||||||||||||| || | |||||||||||||||||||||    
T  4537888 atatccttaaccagtgccccggaggcaccggttagcatttccctta 4537933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 13643059 - 13643010
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    ||||| |||||||||||||||||| |||| ||||||||||||||| ||||    
T  13643059 ttttcgtatccttaaccagtgccccgggggcaccggttagcattttcctt 13643010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 13743484 - 13743435
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    ||||| |||||||||||||||||| |||| ||||||||||||||| ||||    
T  13743484 ttttcgtatccttaaccagtgccccgggggcaccggttagcattttcctt 13743435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 20831692 - 20831737
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttc 46  Q
    ||||||||||||||||||||| || |||| ||||||||||||||||    
T  20831692 ttttcatatccttaaccagtgtcccgggggcaccggttagcatttc 20831737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 48
Target Start/End: Original strand, 39751617 - 39751658
Alignment:
Q  7 tatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||||||||||||||||| |||| ||||||||||||||||||    
T  39751617 tatccttaaccagtgccccgggggcaccggttagcatttccc 39751658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 12652677 - 12652630
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||||||||||||||||||||| |  ||| ||||||||||||||||||    
T  12652677 ttttcatatccttaaccagtgctccaggggcaccggttagcatttccc 12652630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 37373252 - 37373206
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    ||||||||||||||||||||| || |||| ||||||||||||||||||    
T  37373252 ttttcatatccttaaccagtgtcc-gggggcaccggttagcatttccc 37373206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 10618065 - 10618015
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    ||||||||||||||||| ||||||| | | ||||||||||||||| |||||    
T  10618065 ttttcatatccttaacctgtgccctagaggcaccggttagcattttcctta 10618015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 16888683 - 16888728
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcc 47  Q
    ||||||||||||||||| |||||| |||| |||||||||||||||||    
T  16888683 ttttcatatccttaacctgtgccc-gggggcaccggttagcatttcc 16888728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 21595893 - 21595848
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcc 47  Q
    |||||||| ||||||||||||||| |||| |||||||||||||||||    
T  21595893 ttttcatacccttaaccagtgccc-gggggcaccggttagcatttcc 21595848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 2805399 - 2805452
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttatat 54  Q
    ||||||||||||||||||||| || |||| ||| ||||| |||||||| |||||    
T  2805399 ttttcatatccttaaccagtgtcccgggggcactggttaacatttcccatatat 2805452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 48
Target Start/End: Complemental strand, 29566741 - 29566700
Alignment:
Q  7 tatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    ||||||||||| |||||| |||| ||||||||||||||||||    
T  29566741 tatccttaacccgtgccccgggggcaccggttagcatttccc 29566700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 51
Target Start/End: Original strand, 2490334 - 2490378
Alignment:
Q  7 tatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    ||||||||||| |||||| || | |||||||||||||||||||||    
T  2490334 tatccttaacctgtgccccggaggcaccggttagcatttccctta 2490378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 43119264 - 43119216
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||||||||| |||| |||||||| | || |||||||||||||||||||    
T  43119264 ttttcatatctttaatcagtgccccgagggcaccggttagcatttccct 43119216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0264 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0264
Description:

Target: scaffold0264; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 23008 - 22959
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctt 50  Q
    |||||||||||||||||||||| | |||| ||||||||||||||||||||    
T  23008 ttttcatatccttaaccagtgctccgggggcaccggttagcatttccctt 22959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 53824 - 53872
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||||||| ||||||||||||||| |||| |||||||||||||||||||    
T  53824 ttttcatacccttaaccagtgccccgggggcaccggttagcatttccct 53872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0190 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0190
Description:

Target: scaffold0190; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 14943 - 14896
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccc 48  Q
    |||| ||||| ||||||||||||| |||||||||||||||||||||||    
T  14943 tttttatatctttaaccagtgccccggggacaccggttagcatttccc 14896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0188 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0188
Description:

Target: scaffold0188; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 6249 - 6295
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcc 47  Q
    ||||||||||||||||||||||||  ||| |||||||||||||||||    
T  6249 ttttcatatccttaaccagtgccccaggggcaccggttagcatttcc 6295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1266 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold1266
Description:

Target: scaffold1266; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 339 - 292
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    ||||||||| ||||||||||||||||||| |||||||||| ||||||||    
T  339 ttttcatatgcttaaccagtgccctgggg-caccggttaggatttccct 292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 116251 - 116201
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccctta 51  Q
    |||||||||| |||||| |||||| |||| ||||||||||||||| |||||    
T  116251 ttttcatatctttaacctgtgccccgggggcaccggttagcattttcctta 116201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0045 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0045
Description:

Target: scaffold0045; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 50595 - 50538
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttcccttatattaaa 58  Q
    |||||||||| ||||||||||||| || | ||||||||| |||||||| ||| |||||    
T  50595 ttttcatatctttaaccagtgccccggaggcaccggttaacatttcccatattttaaa 50538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1152 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold1152
Description:

Target: scaffold1152; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 725 - 677
Alignment:
Q  1 ttttcatatccttaaccagtgccctggggacaccggttagcatttccct 49  Q
    |||||||||| |||||| |||| |||||| ||||| |||||||||||||    
T  725 ttttcatatctttaacccgtgctctgggggcaccgattagcatttccct 677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University