View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13331_high_14 (Length: 364)
Name: NF13331_high_14
Description: NF13331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13331_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 9 - 349
Target Start/End: Complemental strand, 42863996 - 42863656
Alignment:
| Q |
9 |
gcatttcgtcggtcacggtaatcgatttcatacgcaaaacacacaaggaattaaatctttccaccttaaagatgtgcaatggaagaacataaacaattgt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42863996 |
gcatttcgtcggtcacggtaatcgatttcatacgcaaaacacacaaggaattaaatctttccaccttaaagatgtgcaatggaagaacataaacaattgt |
42863897 |
T |
 |
| Q |
109 |
atgaccaaaatacacttcaagcttttgaaccnnnnnnngaactgcaaagtgaatccagttatcaatatcactaacatttttcataggaaaccaaaacttc |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42863896 |
atgaccaaaatacagttcaagcttttgaacctttttttgaactgcaaagtgaatccagttatcaatatcactaacatttttcataggaaaccaaaacttc |
42863797 |
T |
 |
| Q |
209 |
aatccttgtaaagtggaacattgaagtgaacttaacaactcattgatccaacttgtatatgtttgtctttcagcatcatacatgatttccattgccattt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42863796 |
aatccttgtaaagtggaacattgaagtgaacttaacaactcattgatccaacttgtatatgtttgtctttcagcatcatacatgatttccattgccattt |
42863697 |
T |
 |
| Q |
309 |
gtaaacgccctcctgtaacctttttaagatattttttcatg |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
42863696 |
gtaaacgccctcctgtaacctttttaagatcttttatcatg |
42863656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University