View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13331_high_16 (Length: 311)
Name: NF13331_high_16
Description: NF13331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13331_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 205 - 293
Target Start/End: Original strand, 32224942 - 32225030
Alignment:
| Q |
205 |
gttttgcagtagcttaattgaattacgaaagtgattttgaatttgattatgatgattgaaattgcgtttggagtttgaagtagtgaagt |
293 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224942 |
gttttgtagtagcttaattgaattacgaaagtgattttgtatttgattatgatgattgaaattgcgtttggagtttgaagtagtgaagt |
32225030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 89 - 122
Target Start/End: Original strand, 32224835 - 32224868
Alignment:
| Q |
89 |
ctacacaaatttcatcacgaaaacactcgattca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32224835 |
ctacacaaatttcatcacgaaaacactcgattca |
32224868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University