View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13331_high_6 (Length: 498)
Name: NF13331_high_6
Description: NF13331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13331_high_6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 407; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 407; E-Value: 0
Query Start/End: Original strand, 24 - 498
Target Start/End: Complemental strand, 44474209 - 44473734
Alignment:
| Q |
24 |
cccttccttccttccacttccatttcccatttcattatttagttgagatcgattgatccctttctcgcttcatcaatgatgtatgcagtattttggttgc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44474209 |
cccttccttccttccacttccatttcccattttattatttagttgagatcgattgatccctttctcgcttcatcaatgatgtatgtagtattttggttgc |
44474110 |
T |
|
| Q |
124 |
tttgggaaatgtaaaataacccgagggagtactatttatcaagtataataaaattttgttattattctaagtcgttgtgtaattttatgagaattgatcg |
223 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44474109 |
tttgagaaatgtaaaataacccgagggagtactatttatcaagtataataaaattttgttattattctaagtcgttgtgtaattttatgagaattgatcg |
44474010 |
T |
|
| Q |
224 |
gttgannnnnnnnnnnnnnn-gggtggttccttggaatgtctatggtttcgaggttgcttgtttattttagtaacagttttctttatgccactggatggc |
322 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44474009 |
gttgattttttttttttttttggggggttccttggaatgtctatggtttcgaggttgcttgtttattttagtaacagttttctttatgccactggatggc |
44473910 |
T |
|
| Q |
323 |
tacaatgtggcagtctttgaaattggtgatgagtccggtgacttttgaagagtctccgtaatgttcgagtaggggcttacaaattgtactcctttcacag |
422 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44473909 |
tacaatgtggcagtctttgaaattggtgatgagtccggtgacttttgaagagtctccgtaatgttcgagtaggggcttacaaattgtactcctttcacag |
44473810 |
T |
|
| Q |
423 |
acaatggatgtgtttatgctactggtctcaatgattttggacagctcggtacatcggagagtaaaccctactcagt |
498 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44473809 |
acaatggatgtgtttatgctactggtctcaatgattttggacagctcggtacatcggagagtaaaccctactcagt |
44473734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University