View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13331_low_11 (Length: 437)
Name: NF13331_low_11
Description: NF13331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13331_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 18 - 429
Target Start/End: Original strand, 44727071 - 44727479
Alignment:
| Q |
18 |
cttccttggtggcggtggaatttgtagatctttttgctttgttgtgggataattgcttttatgcaatttactccttcaaaggtggtgattttttcatgac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44727071 |
cttccttggtggcggtggaatttgtagatctttttgctttgctgtgggataattgcttttatgcaatttactccttcaaaggtggtgattttttcatgac |
44727170 |
T |
|
| Q |
118 |
aattgcttttatcacgcctacggacaaggtgcaacttagggaggagaggggtgttcggcaacagttggattccgagttgagtgtgttgcaatgatgtcca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44727171 |
aattgcttttatcacgcctacggacaaggtgcaacttagggaggagaggggtgttcggcaacagttggattccgagttgtgtgtgttgcaatgatgtcca |
44727270 |
T |
|
| Q |
218 |
agaaacagaagaacatttgtttgctaaatgtggtttttcgggcactgtttggtatgtggtattcaagtggcttggcttcaactcggttttgtcggggaat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44727271 |
agaaacagaagaacatttgtttgctaaatgtggtttttcgggcactgtttggtatgtggtattcaagtggcttggcttcaactcggttttgtcggggaat |
44727370 |
T |
|
| Q |
318 |
ttgtttattttgctccaaacttttacttcgtttgaaaagctaggaactagaaatcttcataaattttcgcttcacgttaaaattttagttgaaataattc |
417 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||| |
|
|
| T |
44727371 |
ttgtttattttgctccaaacttttatttcgtttgaaaagctaggaactagaaatcttcataaattttgcaatta---taaaattttagttgaaataattc |
44727467 |
T |
|
| Q |
418 |
aataattcatct |
429 |
Q |
| |
|
|||||||||||| |
|
|
| T |
44727468 |
aataattcatct |
44727479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University