View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13331_low_20 (Length: 311)

Name: NF13331_low_20
Description: NF13331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13331_low_20
NF13331_low_20
[»] chr6 (2 HSPs)
chr6 (205-293)||(32224942-32225030)
chr6 (89-122)||(32224835-32224868)


Alignment Details
Target: chr6 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 205 - 293
Target Start/End: Original strand, 32224942 - 32225030
Alignment:
205 gttttgcagtagcttaattgaattacgaaagtgattttgaatttgattatgatgattgaaattgcgtttggagtttgaagtagtgaagt 293  Q
    |||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
32224942 gttttgtagtagcttaattgaattacgaaagtgattttgtatttgattatgatgattgaaattgcgtttggagtttgaagtagtgaagt 32225030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 89 - 122
Target Start/End: Original strand, 32224835 - 32224868
Alignment:
89 ctacacaaatttcatcacgaaaacactcgattca 122  Q
    ||||||||||||||||||||||||||||||||||    
32224835 ctacacaaatttcatcacgaaaacactcgattca 32224868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University