View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13331_low_25 (Length: 237)

Name: NF13331_low_25
Description: NF13331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13331_low_25
NF13331_low_25
[»] chr4 (1 HSPs)
chr4 (1-144)||(26597966-26598110)


Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 26597966 - 26598110
Alignment:
1 gatggacttgagacataagttggcatatataggaggacgaaactcctagatcgacaactgtc-tggatgacaattgtagagagatcatgatgcgatcttc 99  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||    
26597966 gatggacctgagacataagttggcatatataggaggacgaaactcctagatcgacaactgtcttggatgacaattgtagatagatcatgatgcgatcttc 26598065  T
100 atcacattgttttgatttgctctcagaacatgattggatgtgcct 144  Q
    |||||||||| ||||||||||||||  ||||| |||| |||||||    
26598066 atcacattgtcttgatttgctctcaagacatggttgggtgtgcct 26598110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University