View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13331_low_25 (Length: 237)
Name: NF13331_low_25
Description: NF13331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13331_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 26597966 - 26598110
Alignment:
| Q |
1 |
gatggacttgagacataagttggcatatataggaggacgaaactcctagatcgacaactgtc-tggatgacaattgtagagagatcatgatgcgatcttc |
99 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26597966 |
gatggacctgagacataagttggcatatataggaggacgaaactcctagatcgacaactgtcttggatgacaattgtagatagatcatgatgcgatcttc |
26598065 |
T |
 |
| Q |
100 |
atcacattgttttgatttgctctcagaacatgattggatgtgcct |
144 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||| ||||||| |
|
|
| T |
26598066 |
atcacattgtcttgatttgctctcaagacatggttgggtgtgcct |
26598110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University