View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13331_low_27 (Length: 219)
Name: NF13331_low_27
Description: NF13331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13331_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 40786958 - 40786776
Alignment:
| Q |
20 |
tctcatgtaccaaaatttgctttagacctcccttattgttaaagattattggaccagtcctaaccagtaacaacattaaattcagagaccccttagtgca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40786958 |
tctcatgtaccaaaatttgctttagacctcccttattgttaaagattattggaccagtcctaactagtaacaacattaaattcagagaccccttagtgca |
40786859 |
T |
|
| Q |
120 |
tacctatgcaaactgtacccatcttaatacatatagcaaagccgaaacttcttcataaacttgcatctcagtacagttccaac |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40786858 |
tacctatgcaaactgtacccatcttaatacataaagcaaagccgaaacttcttcataaacttgcatctcagtacagttccaac |
40786776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 75
Target Start/End: Original strand, 45166034 - 45166092
Alignment:
| Q |
20 |
tctcatgtaccaaaatt---tgctttagacctcccttattgttaaagattattggacca |
75 |
Q |
| |
|
|||||| |||||||||| ||||||||| ||| |||||| |||||||||||||||||| |
|
|
| T |
45166034 |
tctcatataccaaaattacttgctttagatctctcttatttttaaagattattggacca |
45166092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University