View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13332_low_4 (Length: 252)
Name: NF13332_low_4
Description: NF13332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13332_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 84 - 233
Target Start/End: Original strand, 350492 - 350641
Alignment:
| Q |
84 |
caattaatctatgttattttctgtttaggactgtaagaagacttttccttcagctttatgtttgggaggctcattgcaagctgtcacacgttctattcgc |
183 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
350492 |
caattaatctatcttgttttctgtttaggactgtaagaagacttttccttcagctttatgtttgggaggctcattgcaagctgtcacacgttctattcgc |
350591 |
T |
 |
| Q |
184 |
ggccacggtaatgaattaacttcatccactgccttactctacattgcagt |
233 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
350592 |
ggccacggtaattaattaacttcatccagtgccttactctacattgcagt |
350641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University