View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13334_high_2 (Length: 217)

Name: NF13334_high_2
Description: NF13334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13334_high_2
NF13334_high_2
[»] chr1 (1 HSPs)
chr1 (21-181)||(38738313-38738473)


Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 21 - 181
Target Start/End: Complemental strand, 38738473 - 38738313
Alignment:
21 aattatatggcacgagaaatatatatacttaattaacaaataattgataaaatgaattattcttgatagacttgtcatgtatattaacattttcaggaaa 120  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||    
38738473 aattatatggcacgagaaatatatatacttaattaacaaataattgataaaatggattattcttgatagatttgtcatgtatattaacattttcaggaaa 38738374  T
121 caaatctctataaaattgttttatacatgtacttcgtgtatgcatatacagagattcataa 181  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38738373 caaatctctataaaattgttttatacatgtacttcgtgtatgcatatacagagattcataa 38738313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University