View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13334_low_2 (Length: 217)
Name: NF13334_low_2
Description: NF13334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13334_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 21 - 181
Target Start/End: Complemental strand, 38738473 - 38738313
Alignment:
| Q |
21 |
aattatatggcacgagaaatatatatacttaattaacaaataattgataaaatgaattattcttgatagacttgtcatgtatattaacattttcaggaaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38738473 |
aattatatggcacgagaaatatatatacttaattaacaaataattgataaaatggattattcttgatagatttgtcatgtatattaacattttcaggaaa |
38738374 |
T |
 |
| Q |
121 |
caaatctctataaaattgttttatacatgtacttcgtgtatgcatatacagagattcataa |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38738373 |
caaatctctataaaattgttttatacatgtacttcgtgtatgcatatacagagattcataa |
38738313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University