View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13335_low_11 (Length: 282)
Name: NF13335_low_11
Description: NF13335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13335_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 9 - 257
Target Start/End: Complemental strand, 7589948 - 7589688
Alignment:
| Q |
9 |
agcagagaagcgaagagatgatgcagcggcctcatcagcagttggggcggcagcgggagccacgtcatcagaagcaggggcagttccaggagcgaagaga |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
7589948 |
agcagagaagcgaagagatgatgcagcggcctcatcagcagttggggcggcagcgggagccacgtcatcagaagcaggggcggatccaggagcgaagaga |
7589849 |
T |
 |
| Q |
109 |
tcatcagcaggggatggtgatggtggagatgaaatttcttcatcagcctcgggtgaagagg------------cgggtgaagagacaggagcatcggttg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
7589848 |
tcatcagcaggggatggtgatggtggagatgaaatttcttcatcagcctcgggtgaagaggcaggtgaagcctcgggtgaagagacaggagcatcagttg |
7589749 |
T |
 |
| Q |
197 |
aaggtgctggtgttggtgctgaagtggtagcttttggagaagatgctggtgcttctgattc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7589748 |
aaggtgctggtgttggtgctgaagtggtagcttttggagaagatgctggtgcttctgattc |
7589688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University