View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13336_high_14 (Length: 231)
Name: NF13336_high_14
Description: NF13336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13336_high_14 |
 | |
|
| [»] scaffold0771 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0771 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: scaffold0771
Description:
Target: scaffold0771; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 15 - 177
Target Start/End: Complemental strand, 3316 - 3155
Alignment:
| Q |
15 |
aatatatagtactacggtttagattacaacagtatcactaaatcgtactgtgcaataacgacgattaggcctaacacacgtttagggtcaaacacaaggg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||| |||| || || ||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
3316 |
aatatatagtactacggtttagattacaacaatatccctaaatcgtactgcgcaacaatgaagattaggcctaacacacgttt-gggtcaaacgcaaggg |
3218 |
T |
|
| Q |
115 |
tatgggtggagggagctcttcacaatgctctgctagctcagctttgtctccgccccttgcccc |
177 |
Q |
| |
|
|| ||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3217 |
taggggcggagggagctcttcacaatgctctgctagctcagcttcgtctccgccccttgcccc |
3155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 15 - 177
Target Start/End: Complemental strand, 13951176 - 13951015
Alignment:
| Q |
15 |
aatatatagtactacggtttagattacaacagtatcactaaatcgtactgtgcaataacgacgattaggcctaacacacgtttagggtcaaacacaaggg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||| |||| || || ||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
13951176 |
aatatatagtactacggtttagattacaacaatatccctaaatcgtactgcgcaacaatgaagattaggcctaacacacgttt-gggtcaaacgcaaggg |
13951078 |
T |
|
| Q |
115 |
tatgggtggagggagctcttcacaatgctctgctagctcagctttgtctccgccccttgcccc |
177 |
Q |
| |
|
|| ||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13951077 |
taggggcggagggagctcttcacaatgctctgctagctcagcttcgtctccgccccttgcccc |
13951015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 42500831 - 42500790
Alignment:
| Q |
162 |
ctccgccccttgcccctcttctatgtaaatatatgagccata |
203 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
42500831 |
ctccgccccttgcccctcttctatgtgtatataggagccata |
42500790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University