View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13336_low_16 (Length: 245)
Name: NF13336_low_16
Description: NF13336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13336_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 37566832 - 37567055
Alignment:
| Q |
1 |
ttaaaaactgaaccgaat--cgaatcagtgggactttttatcgtggttcaacctctttaaaccgtctagtttgtttcgggttttaaaacattgttgaaaa |
98 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
37566832 |
ttaaaaactgaaccgaatatcgaatcagtgggactttttatcgtggttcaacctctttaaaccgtctagtttgattcgggttttaaaagattgttgaaaa |
37566931 |
T |
 |
| Q |
99 |
caagcagaggaattaaggatatattaccatgttaaaatgaggatagccattgagagttgcctattaggtgaagacttttgaatgtcttgttgaaaacaaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37566932 |
caagcagaggaattaaggatatattaccatgttaaaatgaggatagccattgagagttgcctattaggtgaagacttttgaatgtcttgttgaaaacaaa |
37567031 |
T |
 |
| Q |
199 |
aacaaccgcagccacctagcaaat |
222 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37567032 |
aacaaccgcagccacctagcaaat |
37567055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University