View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13336_low_21 (Length: 203)
Name: NF13336_low_21
Description: NF13336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13336_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 58; Significance: 1e-24; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 140 - 201
Target Start/End: Complemental strand, 41780469 - 41780408
Alignment:
| Q |
140 |
tattttcgaccttactatcaaagtcattcttatacgttgttggactgaaaataaggtgtgat |
201 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41780469 |
tattttcgacctaactatcaaagtcattcttatacgttgttggactgaaaataaggtgtgat |
41780408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 140 - 201
Target Start/End: Complemental strand, 41787033 - 41786972
Alignment:
| Q |
140 |
tattttcgaccttactatcaaagtcattcttatacgttgttggactgaaaataaggtgtgat |
201 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41787033 |
tattttcgacctaactatcaaagtcattcttataggttgttggactgaaaataaggtgtgat |
41786972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 144 - 201
Target Start/End: Complemental strand, 41791876 - 41791819
Alignment:
| Q |
144 |
ttcgaccttactatcaaagtcattcttatacgttgttggactgaaaataaggtgtgat |
201 |
Q |
| |
|
|||||||| ||||||||||||||||||||| || | ||||||||||||||||||||| |
|
|
| T |
41791876 |
ttcgacctaactatcaaagtcattcttataggtggcgggactgaaaataaggtgtgat |
41791819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University