View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13338_low_15 (Length: 437)
Name: NF13338_low_15
Description: NF13338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13338_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 18 - 273
Target Start/End: Complemental strand, 10931081 - 10930826
Alignment:
| Q |
18 |
aaacactaccatcaccaccacaaccatcaacatgatcttctcataccaggtcttcctgatcacatagctcaactttgtctatcttcaatcaacccttctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10931081 |
aaacactaccatcaccaccacaaccatcaacatgatcttctcataccaggtcttcctgatcacatagctcaactttgtctatcttcaatcaacccttctc |
10930982 |
T |
 |
| Q |
118 |
ttctcttcaaagtatgtcactcatggcgtagacttatctactcaccttcttttccacctttcttttctctctatgcaattctctcaccacccaaatcaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10930981 |
ttctcttcaaagtatgtcactcatggcgtagacttatctactcaccttcttttccacctttcttttctctctatgcaattctctcaccccccaaatcaca |
10930882 |
T |
 |
| Q |
218 |
tcattcacactcaattcaattccacaactttgatccaatatcaaatacttggaaaa |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
10930881 |
tcattcacactcaattcaattccacaactttgatccaatatcgaacacttggaaaa |
10930826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 348 - 431
Target Start/End: Complemental strand, 10930754 - 10930671
Alignment:
| Q |
348 |
gtccaatctatctccgtttccgataatctcatcctcattgccgccaccactcataatctcaccccagcactctcccatcctttg |
431 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10930754 |
gtccaatctatctccgtctccgataatctcatcctcctcgccgccaccactcataatctcaccccagcactatcccatcctttg |
10930671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University