View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13338_low_26 (Length: 315)
Name: NF13338_low_26
Description: NF13338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13338_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 286; Significance: 1e-160; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 7934641 - 7934946
Alignment:
| Q |
1 |
attgttacaatatgtgccatagacgagttctttgtttctcgataagattcagattttagattaaaaaataataattggtcataagataccatttagtgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7934641 |
attgttacaatatgtgccatagacgagttctttgtttctcgataagattcagattttagattaaaaaataataattggtcataagataccatttagtgac |
7934740 |
T |
 |
| Q |
101 |
tacctatgatgattatatgaattaatatttaaccaaaagttaaggccaatgttttgcatagtttgctttgttgggaacaatgtttatctccattacaaac |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7934741 |
tacctaggatgattatatgaattaatatttaaccaaaagttaaggccaatgttttgcatagtttgctttgttgggaacaatgtttgtctccattacaaac |
7934840 |
T |
 |
| Q |
201 |
aaatgtttcatcattatcttatttttcattgttgtgtcttatgtacatccattatataaatgcaatggcctt-gcataattgtccacactgataccctcc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7934841 |
aaatgtttcatcattatcttatttttcattgttgtgtcttatgtacatccattatataaatgcaatggccttcacataattgtccacactgataccctcc |
7934940 |
T |
 |
| Q |
300 |
cctttg |
305 |
Q |
| |
|
|||||| |
|
|
| T |
7934941 |
cctttg |
7934946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 7934601 - 7934640
Alignment:
| Q |
1 |
attgttacaatatgtgccatagacgagttctttgtttctc |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7934601 |
attgttacaatatgtgccatagacgagttctttgtttctc |
7934640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University