View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13338_low_27 (Length: 310)

Name: NF13338_low_27
Description: NF13338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13338_low_27
NF13338_low_27
[»] chr3 (1 HSPs)
chr3 (73-310)||(7309328-7309565)


Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 73 - 310
Target Start/End: Complemental strand, 7309565 - 7309328
Alignment:
73 cttggaagaatgagatatggaagaatgggcactggagcttcctctaattatgattccgagaactacatcaaaaaagtagaggaaccggatgttttaagga 172  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7309565 cttggaagaatgagatatggaagaatgggcactggagcttcctctaattatgattccgagaactacatcaaaaaagtagaggaaccggatgttttaagga 7309466  T
173 aaagttcgatccctaatgcagcctccggtgttggccgcagtggtgatgttaagaaagggccgatgtttaaggatttagcagggaataggatggagaagat 272  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7309465 aaagttcgatccctaatgcagcctccggtgttggcagcagtggtgatgttaagaaagggccgatgtttaaggatttagcagggaataggatggagaagat 7309366  T
273 aaagaaggaattggaagtgcctcttaatttactgtgtt 310  Q
    ||||||||||||||||||||||||||||||||||||||    
7309365 aaagaaggaattggaagtgcctcttaatttactgtgtt 7309328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University