View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13338_low_27 (Length: 310)
Name: NF13338_low_27
Description: NF13338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13338_low_27 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 73 - 310
Target Start/End: Complemental strand, 7309565 - 7309328
Alignment:
| Q |
73 |
cttggaagaatgagatatggaagaatgggcactggagcttcctctaattatgattccgagaactacatcaaaaaagtagaggaaccggatgttttaagga |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7309565 |
cttggaagaatgagatatggaagaatgggcactggagcttcctctaattatgattccgagaactacatcaaaaaagtagaggaaccggatgttttaagga |
7309466 |
T |
 |
| Q |
173 |
aaagttcgatccctaatgcagcctccggtgttggccgcagtggtgatgttaagaaagggccgatgtttaaggatttagcagggaataggatggagaagat |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7309465 |
aaagttcgatccctaatgcagcctccggtgttggcagcagtggtgatgttaagaaagggccgatgtttaaggatttagcagggaataggatggagaagat |
7309366 |
T |
 |
| Q |
273 |
aaagaaggaattggaagtgcctcttaatttactgtgtt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7309365 |
aaagaaggaattggaagtgcctcttaatttactgtgtt |
7309328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University