View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13338_low_29 (Length: 300)
Name: NF13338_low_29
Description: NF13338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13338_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 20 - 290
Target Start/End: Complemental strand, 45693644 - 45693374
Alignment:
| Q |
20 |
gtttctatactagatttctcatatatttttgtttttgctgacttgatatttcttaggcggataaagcttcaatgctagatgaggcaattgagtatcttaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45693644 |
gtttctatactagatttctcatatatttttgtttttgctgacttgatatttcttaggcggataaagcttcaatgctggatgaggcaattgagtatcttaa |
45693545 |
T |
 |
| Q |
120 |
atcacttcaactccaactgcaagtattctttctcttcccttttacattttcccttcaatcctttgaattttgatatttcacattatattatatccattct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45693544 |
atcacttcaactccaactgcaagtattctttctcttcccttttacattttcccttcaatcctttgaattttgatatttcacattatattatatccattct |
45693445 |
T |
 |
| Q |
220 |
aacgcgatattttttctgatctttttacacagatcatgtcaatgggaggtggtggtttatacatgcctatg |
290 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45693444 |
aatgcgatattttttctgatctttttacacagatcatgtcaatgggaggtggtggtttatacatgcctatg |
45693374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 73 - 144
Target Start/End: Original strand, 37935686 - 37935757
Alignment:
| Q |
73 |
taggcggataaagcttcaatgctagatgaggcaattgagtatcttaaatcacttcaactccaactgcaagta |
144 |
Q |
| |
|
|||| |||||||||||| ||||| |||||||||||||||||||| ||| ||||||| |||||| | |||||| |
|
|
| T |
37935686 |
taggtggataaagcttctatgctggatgaggcaattgagtatctaaaaacacttcagctccaagttcaagta |
37935757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University