View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13338_low_32 (Length: 263)
Name: NF13338_low_32
Description: NF13338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13338_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 253
Target Start/End: Original strand, 45672805 - 45673036
Alignment:
| Q |
19 |
caacagtaatatgagtcatcctttgattttcaatctcttctttgttctttgcactcttgatacgacgacgctttctcctacacgatgctgttactgttgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45672805 |
caacagtaatatgagtcatcctttgattttcaatctcctctttgttctttgcactcttgatacgacgacgctttctcctacacgatgctgttactgt--- |
45672901 |
T |
 |
| Q |
119 |
agcttcttccacggtggaagaaggaggtgctgtgatagtttgatcaacggtgcagatttcaggagaggaagagtgtgaatattcccattgatgatcccag |
218 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45672902 |
agcttcctccatggtggaagaaggaggtgctgtgatagtttgatcaacggtgcagatttcaggagaggaagagtgtgaatattcccattgatgatcccag |
45673001 |
T |
 |
| Q |
219 |
tttgcatggagattttgttgttcattgttgatgat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45673002 |
tttgcatggagattttgttgttcattgttgatgat |
45673036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University