View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13338_low_33 (Length: 247)
Name: NF13338_low_33
Description: NF13338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13338_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 23 - 229
Target Start/End: Original strand, 31408691 - 31408897
Alignment:
| Q |
23 |
ggactcacagattgctcaatgatagcgatcttaacgttaggattcttgctaagctcataagcacatgacaaaccagcagaaccagcaccaacgatgacga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31408691 |
ggactcacagattgctcaatgatagcgatcttaacgttaggattcttgctaagctcataagcacatgacaaaccagcagaaccagcaccaacgatgacga |
31408790 |
T |
 |
| Q |
123 |
cgtcggtatcggcatgagtcaccatgtccgtcatgtacctacgagtcatctcacgtgccacaattgactccttgatcggagcaaatttgaaggcgttgag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31408791 |
cgtcggtatcggcatgagtcaccatgtccgtcatgtacctacgagtcatctcacgtgccacaattgactccttgatcggagcaaatttgaaggcgttgag |
31408890 |
T |
 |
| Q |
223 |
atcatag |
229 |
Q |
| |
|
||||||| |
|
|
| T |
31408891 |
atcatag |
31408897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University