View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13338_low_36 (Length: 229)
Name: NF13338_low_36
Description: NF13338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13338_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 161
Target Start/End: Original strand, 1746981 - 1747141
Alignment:
| Q |
1 |
atcaaatccagatgatacaattcaagggaaagcaaagaaaaacaatgtaatttataactttgtataacacataactaattgcattatattgcacattata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1746981 |
atcaaatccagatgatacaattcaagggaaagcaaagaaaaacaatgtaatttataactttgtataacacataactaattgcattatattgcaccttata |
1747080 |
T |
|
| Q |
101 |
taaaaatcttaacatacaagattactaggaaattatggtgcatagagtaataatcaaatac |
161 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1747081 |
taaaaatcttaccatacaagattactaggaaattatggtgcatagagtaataatcaaatac |
1747141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University