View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13338_low_40 (Length: 202)
Name: NF13338_low_40
Description: NF13338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13338_low_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 22 - 189
Target Start/End: Original strand, 52170507 - 52170674
Alignment:
| Q |
22 |
cccaagttaacaatggatgattctttcttgaaatacagtattcttgaatgggacaattcaacacagaaactcagagttactagggaagattactcgagag |
121 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52170507 |
cccaagttaacaacggatgattctttcttgaaatacagtattcttgaatgggacaattcaacacagaagctcagagttactagggaagattactcgagag |
52170606 |
T |
|
| Q |
122 |
atgatgtttgtgttcctgtcgacaacatcacattcaatagcagtttgtttaaactttatgatgatgtc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52170607 |
atgatgtttgtgttcctgtcgacaacatcacattcaatagcactttgtttaaactttatgatgatgtc |
52170674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 52 - 99
Target Start/End: Complemental strand, 31610416 - 31610369
Alignment:
| Q |
52 |
aaatacagtattcttgaatgggacaattcaacacagaaactcagagtt |
99 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
31610416 |
aaataccgtattcttgaatgggacaatacaacacagagactcagagtt |
31610369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 52 - 115
Target Start/End: Complemental strand, 31621257 - 31621194
Alignment:
| Q |
52 |
aaatacagtattcttgaatgggacaattcaacacagaaactcagagttactagggaagattact |
115 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||| ||| |||| || ||||||| |
|
|
| T |
31621257 |
aaataccgtattcttgaatgggacaatacaacacagaaactcacagtcgctagagacgattact |
31621194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 52 - 115
Target Start/End: Complemental strand, 31636252 - 31636189
Alignment:
| Q |
52 |
aaatacagtattcttgaatgggacaattcaacacagaaactcagagttactagggaagattact |
115 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||| ||| |||| || ||||||| |
|
|
| T |
31636252 |
aaataccgtattcttgaatgggacaatacaacacagaaactcacagtcgctagagacgattact |
31636189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University