View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13338_low_41 (Length: 201)
Name: NF13338_low_41
Description: NF13338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13338_low_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 149
Target Start/End: Complemental strand, 28672685 - 28672544
Alignment:
| Q |
1 |
ggcgaggttggattacaaggtcgaatctggtgggcatcctgggccgcacgggtgatgctcatttaccgttgctcgcagagccggccgagaaggattattg |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
28672685 |
ggcgaggttggattacagggtcgaatctggtgggcatcctgggccgcacgggtggtgctcatttaccattgctcgcagagccggctgagaaggattattg |
28672586 |
T |
|
| Q |
101 |
gtatatggtggtaactgtcctagtgtcttgatgacattttcttctctgc |
149 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
28672585 |
gtatatggtagta-------tagtgtcttgatgacattttcttctctgc |
28672544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 28676185 - 28676136
Alignment:
| Q |
127 |
cttgatgacattttcttctctgctattgctcaaagttagttggtgaataa |
176 |
Q |
| |
|
|||||||| ||||||||| |||| ||||||||| ||||||||||||||| |
|
|
| T |
28676185 |
cttgatgatattttcttccttgctcttgctcaaaattagttggtgaataa |
28676136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University