View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13338_low_7 (Length: 528)
Name: NF13338_low_7
Description: NF13338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13338_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 1e-91; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 233 - 517
Target Start/End: Original strand, 25494062 - 25494346
Alignment:
| Q |
233 |
atggtgtatttaatgttgggttcaatgaagtggttattgaacttcagttaaggacaaactactcgagagaatttgagtttgatttttggctgagcaaact |
332 |
Q |
| |
|
|||||||||||||| |||||||||| ||| ||||||| |||||||||||||| ||||||||||||| |||||||||||| |||||| | |||||||| |
|
|
| T |
25494062 |
atggtgtatttaatattgggttcaa----gtgattattgaccttcagttaaggacgaactactcgagaggatttgagtttgaattttggttaagcaaact |
25494157 |
T |
 |
| Q |
333 |
ttatttatctctgatcaaacgccagattac----gtctcttttctttaaaattaaaagattaagacaaaaaatgacaatttttgggaattctaacatttt |
428 |
Q |
| |
|
|||||| | || ||||||| | ||||| ||||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25494158 |
ttatttgtgtccgatcaaatttcggattatcagagtctcttttctctaaaactaaaggattaagacaaaaaatgacaatttttgggaattctaacatttt |
25494257 |
T |
 |
| Q |
429 |
ttgttgtgaatattcaggttcagtgtagattttggcaagaatgaggtagaggttatgaagcatgtgtcaatctacttagattcatctca |
517 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25494258 |
ttgttatgaatattcaggttcagtgtagattttggcaagaatgaggtagaagttatgaagcatgtgtcaatctacttagattcatctca |
25494346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 442 - 517
Target Start/End: Complemental strand, 28225970 - 28225895
Alignment:
| Q |
442 |
tcaggttcagtgtagattttggcaagaatgaggtagaggttatgaagcatgtgtcaatctacttagattcatctca |
517 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28225970 |
tcaggttcagtgtagattttggcaagaatgaggtagaggttatgaagcatgtgtcaatctacttagattcatctca |
28225895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 25493468 - 25493560
Alignment:
| Q |
1 |
ttaatgcaaaggctgcatatgccagtaagatcctgaaatggtaagttctatgaaattcaagtatgattgatgtcctttttggtaaatttaaac |
93 |
Q |
| |
|
|||||||||||| |||| || |||||||||||||||||||||||||||||||| |||| | |||||||||||| ||||| |||| |||||||| |
|
|
| T |
25493468 |
ttaatgcaaaggttgcacataccagtaagatcctgaaatggtaagttctatgagattctaatatgattgatgttcttttaggtagatttaaac |
25493560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University