View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1333_low_19 (Length: 302)
Name: NF1333_low_19
Description: NF1333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1333_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 46936765 - 46936517
Alignment:
| Q |
1 |
tgtgcaaattgccatgataaacgtctaggtccacacaagattcaagggattggtgctggctttgttcccggggtattggacgttagtcttgtcgacgaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46936765 |
tgtgcaaattgccatgataaacgtctaggtccacacaagattcaagggattggtgctggctttgttcccggggtattggacgttagtcttgtcgacgaag |
46936666 |
T |
 |
| Q |
101 |
taattcaagtaagttttaagg-------nnnnnnnataatggtgcactaaaacccggggtgttggttgttagtcttgttggatgttagtcttgtcg-caa |
192 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
46936665 |
taattcaagtaagttttaaggtttttttaataattataatggtgcactaaaacccggggtgttggttgttagtcttgttggatgttagtcttgtcgacga |
46936566 |
T |
 |
| Q |
193 |
agtaattcaagtaagttcccagggtgctgctttagtttttactgctggc |
241 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46936565 |
agtaattcaagtaagttcccggggtgctgctttagtttttactgctggc |
46936517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 25125505 - 25125594
Alignment:
| Q |
1 |
tgtgcaaattgccatgataaacgtctaggtccacacaagattcaagggattggtgctggctttgttcccggggtattggacgttagtctt |
90 |
Q |
| |
|
||||||||||||||||| ||||||||| | ||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
25125505 |
tgtgcaaattgccatgacaaacgtctacgaccacacaagattcaagggattggtgctggttttgttaccggggtattggacgttagtctt |
25125594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 27 - 65
Target Start/End: Original strand, 863366 - 863404
Alignment:
| Q |
27 |
aggtccacacaagattcaagggattggtgctggctttgt |
65 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
863366 |
aggtcctcacaagattcaagggattggtgctggctttgt |
863404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University