View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1333_low_21 (Length: 285)
Name: NF1333_low_21
Description: NF1333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1333_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 55 - 247
Target Start/End: Original strand, 700126 - 700319
Alignment:
| Q |
55 |
caagatgatgatgatataaggcagaagcagcagatggcaatcatagtatgtggtagccctatgcccctatctgcagcaggtctttcctacacttcaactc |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
700126 |
caagatgatgatgatataaggcagaagcagcagttggcaatcatagtatgtggtagccctatgcccctatctgcagcaggtctttcctacacttcaactc |
700225 |
T |
 |
| Q |
155 |
atcattatgatgacgtgccttgtccctcacttcaatgcaaatatttgtaggacttgacttaacatattgcttgc-tctaatgcttcatgttcat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
700226 |
atcattatgatgacgtgccttgtccctcacttcaatgcaaatatttgtaggacttgacttaacatattgcttgcttctaatgcttcatgttcat |
700319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University