View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1333_low_23 (Length: 269)
Name: NF1333_low_23
Description: NF1333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1333_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 29 - 246
Target Start/End: Original strand, 30757468 - 30757685
Alignment:
| Q |
29 |
attaatcagctcaccatgaagcttttcctgaatatttgaagtgtcatcagtaccgaatgaaattgtggcagggatatgctcttcattcacaatggcaata |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30757468 |
attaatcagctcaccatgaagcttttcctgaatatttgaagtgtcatcagtaccgaatgaaattgtggcagggatatgctcttcattcacaatggcaata |
30757567 |
T |
 |
| Q |
129 |
accgccttattagtaattggtgctgcaaaagctttagaagaacctataccatcaggatctttcttttcaacatatttcagagtcatttgcttccgagcat |
228 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30757568 |
accgccttattagtaattggcgctgcaaaagctttagaagaacctataccatcatgatcgttcttttcaacatatttcagagtcatttgcttccgagcat |
30757667 |
T |
 |
| Q |
229 |
gtgtaggtttcatctcac |
246 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
30757668 |
gtgtaggtttcttctcac |
30757685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University