View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1333_low_27 (Length: 251)
Name: NF1333_low_27
Description: NF1333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1333_low_27 |
 |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 66; Significance: 3e-29; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 138 - 207
Target Start/End: Complemental strand, 2038280 - 2038211
Alignment:
| Q |
138 |
aggcagttgaaacaaagcaaaagtacttatgttccctgtatgatatacgataaaatagggaatgattttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2038280 |
aggcagttgaaacaaagcaaaagtacttgtgttccctgtatgatatacgataaaatagggaatgattttg |
2038211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 138 - 207
Target Start/End: Original strand, 29963802 - 29963872
Alignment:
| Q |
138 |
aggcagttgaaacaaagcaaaagtacttatgtt-ccctgtatgatatacgataaaatagggaatgattttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29963802 |
aggcagttgaaacaaagcaaaagtacttgtgtttccctgtatgatatacgataaaatagggaatgattttg |
29963872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 2038417 - 2038367
Alignment:
| Q |
1 |
agtggaatatctcttacttggtgacgatgaatttcttatagtggactctaa |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2038417 |
agtggaatatctcttacttggtgacgatgaatttcttatagtggactctaa |
2038367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 51
Target Start/End: Original strand, 29963671 - 29963709
Alignment:
| Q |
13 |
cttacttggtgacgatgaatttcttatagtggactctaa |
51 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
29963671 |
cttacttggtgatgatgaatttcttaaagtggactctaa |
29963709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 138 - 204
Target Start/End: Original strand, 188817 - 188883
Alignment:
| Q |
138 |
aggcagttgaaacaaagcaaaagtacttatgttccctgtatgatatacgataaaatagggaatgatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
188817 |
aggcagttgaaacaaagcaaaagtacttgtgttccctctatgatatacgataaaatagggaatgatt |
188883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 138 - 207
Target Start/End: Original strand, 34518532 - 34518601
Alignment:
| Q |
138 |
aggcagttgaaacaaagcaaaagtacttatgttccctgtatgatatacgataaaatagggaatgattttg |
207 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34518532 |
aggcagttgaaacaaagcaaaggtacttgtgttccctgtatgataaacgataaaatagggaatgattttg |
34518601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 207
Target Start/End: Original strand, 12539015 - 12539084
Alignment:
| Q |
140 |
gcagttgaaacaaagcaaaagt-acttatgttccctgtatgatatacgat-aaaatagggaatgattttg |
207 |
Q |
| |
|
|||||||||||||||||||| | |||| ||| |||| ||||||| |||| ||||||||||||||||||| |
|
|
| T |
12539015 |
gcagttgaaacaaagcaaaaataacttgtgtgccctatatgatactcgataaaaatagggaatgattttg |
12539084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University