View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1333_low_5 (Length: 477)
Name: NF1333_low_5
Description: NF1333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1333_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 9e-28; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 401 - 464
Target Start/End: Complemental strand, 10982293 - 10982230
Alignment:
| Q |
401 |
tatatttatctgtaatgttgagttggtggacccacacaaagggacaaaggtctctgctatattc |
464 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10982293 |
tatatttatctgtaatgttgagttggtggacccacacaaagggacaaaggtctctgctatattc |
10982230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 43 - 103
Target Start/End: Complemental strand, 10982775 - 10982715
Alignment:
| Q |
43 |
atactcaaattgattcataggttataatggatcaaaaattaattcactctctttatataaa |
103 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10982775 |
atactcaaattgattcataggttataatgaatcaaaaattaattcactctctttatataaa |
10982715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 95 - 134
Target Start/End: Complemental strand, 10982326 - 10982287
Alignment:
| Q |
95 |
ttatataaaaatgtcaatgactaatacttttattatattt |
134 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10982326 |
ttatataaaaatgtcaatgactaatacttctattatattt |
10982287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University