View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13341_low_12 (Length: 210)
Name: NF13341_low_12
Description: NF13341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13341_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 4e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 22 - 179
Target Start/End: Original strand, 30250874 - 30251031
Alignment:
| Q |
22 |
gttccaactgttacaatgatcaataacatacacgactctttcatttataggcaaagcattccctctattgcttacccacttccgatgtgggacttgtaaa |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30250874 |
gttccaactgttacaatgatcaatggcatacatgactctttcatttataggcaaagcattccctctattgcttacccacttccgatgtgggacttgtaaa |
30250973 |
T |
|
| Q |
122 |
aacaatgaagtgctactaacaacgtggttttgctattggatgtgagactattctttaa |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30250974 |
aacaatgaagtgctactaacaacgtggttttgctattggatgtgagactattctttaa |
30251031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 126
Target Start/End: Complemental strand, 27077283 - 27077221
Alignment:
| Q |
64 |
atttataggcaaagcattccctctattgcttacccacttccgatgtgggacttgtaaaaacaa |
126 |
Q |
| |
|
||||||||||||||| | || ||||||| |||||||||||||||||||| || | ||||||| |
|
|
| T |
27077283 |
atttataggcaaagcttgccatctattgtgtacccacttccgatgtgggatttatgaaaacaa |
27077221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 56 - 126
Target Start/End: Complemental strand, 50240610 - 50240540
Alignment:
| Q |
56 |
actctttcatttataggcaaagcattccctctattgcttacccacttccgatgtgggacttgtaaaaacaa |
126 |
Q |
| |
|
||||||| ||||||||||||||| ||| ||||| |||||||| |||| ||||||||||| ||| ||||||| |
|
|
| T |
50240610 |
actctttgatttataggcaaagcgttctctctactgcttacctactttcgatgtgggacatgtgaaaacaa |
50240540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 116
Target Start/End: Original strand, 31491257 - 31491309
Alignment:
| Q |
64 |
atttataggcaaagcattccctctattgcttacccacttccgatgtgggactt |
116 |
Q |
| |
|
||||||||||||||| | |||||||||| ||| |||||||||||||| ||||| |
|
|
| T |
31491257 |
atttataggcaaagcttgccctctattgtttatccacttccgatgtgagactt |
31491309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University