View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13342_low_3 (Length: 284)
Name: NF13342_low_3
Description: NF13342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13342_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 3083276 - 3083007
Alignment:
| Q |
1 |
aatggaaatcccattcttcatctccgtagatcggttcgttcatcaactatagaaataacttattatataagagaggaaatattaattaagttgcagcatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3083276 |
aatggaaatcccattcttcatctccgtagatcggttcgttcatcaactatagaaataacttattatataagagatgaaatattaattaagttgcagcatc |
3083177 |
T |
|
| Q |
101 |
taaatgatagttactactttgtttttgcagcttctagcagcagatgattgttggaaagcatatagaggtgaaagcactgagcctaaggatcttatcttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3083176 |
taaatgatagttactactttgtttttgcagcttctagcagcagatgattgttggaaagcatatagaggtgaaagtactgagcctaaggatcttatcttta |
3083077 |
T |
|
| Q |
201 |
ctaggaaacgttcatcattgatgcaactaaggaccaaattaaatgtgtttttggcaaataacaacacagg |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3083076 |
ctaggaaacgttcatcattgatgcaactaaggaccaaattaaatgtgtttttggcaaataacaacacagg |
3083007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University