View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13343_high_6 (Length: 293)
Name: NF13343_high_6
Description: NF13343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13343_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 20 - 283
Target Start/End: Original strand, 6138017 - 6138280
Alignment:
| Q |
20 |
cctacatgcaggtaagaagctagaatggcacatcaatttcgtttaggaaattggctaagagaggagagcagcccggtttgcgaagcaaggcaattaagat |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6138017 |
cctaaatgcaggtaagaagctagaatggcacatcaatttcgtttaggaaattggctaagagaggagagcagcccggttcgcgaagcaaggcaattaagat |
6138116 |
T |
|
| Q |
120 |
atatgaggctaatcaattcttcagataatcatgcttcatcttcatcctcttctcctccaagattatttggttcgtctcttggcatggttcctactagtta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6138117 |
atatgaggctaatcaattcttcagataatcatgcttcatcttcatcctcttctcctccaagattatttggttcgtctcttggcatggttcctactagtta |
6138216 |
T |
|
| Q |
220 |
caatgctttggggggtagtagcagcagcaacaacaataaccctagcactaattcccacttcatc |
283 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6138217 |
caatgctttggggggtagtagcagcaacaacaacaataaccctagcactaattcccacttcatc |
6138280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University