View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13343_low_9 (Length: 251)
Name: NF13343_low_9
Description: NF13343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13343_low_9 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 16 - 251
Target Start/End: Complemental strand, 6272919 - 6272684
Alignment:
| Q |
16 |
caaatgcttgaaggtaactcggttacatcctcacagtgatcaagcgtgagctctgagatgttagggaagatatcggcgatgtttgaatcttttccttcaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6272919 |
caaatgcttgaaggtaactcggttacatcctcacagtgatcaagcgtgagctctgagatgttagggaagatatcggcgatgtttgaatcttttccttcaa |
6272820 |
T |
 |
| Q |
116 |
gactgttgttgatcttacaaaggactataaacaatttcctcaagctttccatgactatgcctgataagtgtgagatggaaactttttcaaaccaaaggct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6272819 |
gactgttgttgatcttacaaaggactataaacaatttcctcaagctttccatgactatgcctgataagtgtgggatggaaactttttcaaaccaaaggct |
6272720 |
T |
 |
| Q |
216 |
cctcaagttggttaaattcttgaaaaccgatatatt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6272719 |
cctcaagttggttaaattcttgaaaaccgatatatt |
6272684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 242
Target Start/End: Complemental strand, 6264093 - 6264040
Alignment:
| Q |
189 |
gatggaaactttttcaaaccaaaggctcctcaagttggttaaattcttgaaaac |
242 |
Q |
| |
|
||||||||||||||||| ||| ||||| |||||||||| ||||| |||||||| |
|
|
| T |
6264093 |
gatggaaactttttcaagccacaggcttctcaagttggccaaattgttgaaaac |
6264040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University