View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13346_high_25 (Length: 235)
Name: NF13346_high_25
Description: NF13346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13346_high_25 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 580574 - 580808
Alignment:
| Q |
1 |
aggctaaaaactgcgcttggtttgttgatacatctttggttatgatatacgcgcctctacttgaaagcatttcaatcgaacatagcgtcggtgttccttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
580574 |
aggctaaaaactgcgcttggtttgttgatacatctttggttatgatatacgcgcctctacttgaaagcatttcaatcgaacatagcgtcggtgttccttg |
580673 |
T |
 |
| Q |
101 |
taaacgtgacaaatcatttatctgcttccctgattctgaggatctgaaagaattcagtttttgcggttttgatatatcacaaaacattataattaagtcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
580674 |
taaacgtgacaaatcatttatctgcttccctgattctgaggatctgaaagaattcagtttttgcggttttgatatatcacaaaacattataattaagtcc |
580773 |
T |
 |
| Q |
201 |
ccatgccatgcttcggctaaaatcaatttagatga |
235 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||| |
|
|
| T |
580774 |
ccatgccatgcttcagctaaaatcaatttatatga |
580808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University