View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13346_high_29 (Length: 205)
Name: NF13346_high_29
Description: NF13346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13346_high_29 |
 |  |
|
| [»] scaffold1348 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (2 HSPs) |
 |  |  |
|
| [»] scaffold0067 (1 HSPs) |
 |  |  |
|
| [»] scaffold0053 (1 HSPs) |
 |  |  |
|
| [»] scaffold0360 (1 HSPs) |
 |  |  |
|
| [»] scaffold0495 (1 HSPs) |
 |  |  |
|
| [»] scaffold0457 (1 HSPs) |
 |  |  |
|
| [»] scaffold0352 (1 HSPs) |
 |  |  |
|
| [»] scaffold0432 (1 HSPs) |
 |  |  |
|
| [»] scaffold0402 (1 HSPs) |
 |  |  |
|
| [»] scaffold0287 (1 HSPs) |
 |  |  |
|
| [»] scaffold0778 (1 HSPs) |
 |  |  |
|
| [»] scaffold0595 (1 HSPs) |
 |  |  |
|
| [»] scaffold0061 (1 HSPs) |
 |  |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 4e-83; HSPs: 80)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 25546491 - 25546320
Alignment:
| Q |
18 |
ttgatttctctcatggtcatgaattaaacatgactttggagtaatttatttcaatcataaactacatgcacgaataactaatatatctgtctagaagtcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25546491 |
ttgatttctctcatggtcatgaattaaacatgactttggagtaatttatttcaatcataaactacatgcacgaataactaatatatctgtctagaagtcc |
25546392 |
T |
 |
| Q |
118 |
tagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
25546391 |
tagctcaactggtaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaatccgggacctcacag |
25546320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 31770661 - 31770577
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| ||||||||| |
|
|
| T |
31770661 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggatgtcatgacccgggttcgaacccgggacctcacag |
31770577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 4106738 - 4106821
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4106738 |
gtctagaagtcctagcccaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacag |
4106821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 107 - 176
Target Start/End: Complemental strand, 47250378 - 47250309
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47250378 |
tctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacc |
47250309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 23358184 - 23358268
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||| | |||||||||||||||||| ||||||||| |
|
|
| T |
23358184 |
tgtctagaagtcctagctcaactggcaaataccgaaattgcaaggccggacgtcgtaacccgggttcgaacccgggacctcacag |
23358268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 25112376 - 25112292
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
25112376 |
tgtctagaagtcctagctcaactggcaaataccgaaattgcaaggtcggacgtcatgacctgggttcgaacccgggacctcacag |
25112292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 44083939 - 44084023
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
44083939 |
tgtctagaagtcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacccgggttcgaacccgggacctcacag |
44084023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 110 - 189
Target Start/End: Complemental strand, 43753878 - 43753799
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
43753878 |
agaagtcctagttcaactggcaaatgccgaaattgcaaggccggacgtcgtgacctgggttcgaacccggaacctcacag |
43753799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 47557781 - 47557864
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47557781 |
gtctagaagtcctaactcaactggtaaatgccgaaattacaaggtcgcacgtcatgacccgggttcgaacccggaacctcacag |
47557864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 40058238 - 40058321
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
40058238 |
gtctagaagtcctaactcaactggcaaatgccaaaattgcaaggccggacgttgtgacccgggttcgaacccgggacctcacag |
40058321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 100 - 177
Target Start/End: Original strand, 2146630 - 2146707
Alignment:
| Q |
100 |
atatctgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
2146630 |
atatttgtctagaagtcctagctcaactggaaaatgccgaaattgcaaggccggacgttgtgacccgggttcgaaccc |
2146707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 121 - 189
Target Start/End: Original strand, 4107324 - 4107392
Alignment:
| Q |
121 |
ctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
4107324 |
ctcaactggcaaatgccgaaattgcaaggccggacgtcacgacccgggttcgaacccgggacctcacag |
4107392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 113 - 188
Target Start/End: Complemental strand, 29484876 - 29484801
Alignment:
| Q |
113 |
agtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| | ||||| |||||||| |||||||| |
|
|
| T |
29484876 |
agtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgatctgggtttgaacccgggacctcaca |
29484801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 106 - 188
Target Start/End: Complemental strand, 7162916 - 7162834
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||| |||| |||||||||||||||| ||| |||||||| |
|
|
| T |
7162916 |
gtctaaaagtcctagctcaactggcaaatgccgaaattgtaaggccggacgttgtgacccgggttcgaactcgggacctcaca |
7162834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 109 - 189
Target Start/End: Original strand, 13887174 - 13887254
Alignment:
| Q |
109 |
tagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||| || |||||||||||||||||||| ||||||| ||| ||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
13887174 |
tagaagtcttaactcaactggcaaatgccgaacttgcaagaccggacgtcgtgacccaggttcgaacccggaacctcacag |
13887254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 112 - 189
Target Start/End: Complemental strand, 27229600 - 27229523
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||| |||||||| |||||| |||||||||||||||| ||||| ||||| |||||||||||||| ||||||||| |
|
|
| T |
27229600 |
aagtcctaactcaactgacaaatgtcgaaattgcaaggccggacgtcgtgacctgggttcgaacccgggacctcacag |
27229523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 101 - 189
Target Start/End: Complemental strand, 10220605 - 10220517
Alignment:
| Q |
101 |
tatctgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||| |||||| ||||| | ||||||||| | ||||||||| ||| |||||||||| |
|
|
| T |
10220605 |
tatctgtctagaagtcctaactcaactggcaaaagccaaaattgtaaggcaggacgtcatgatctgggttcgaatccgaaacctcacag |
10220517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 43203306 - 43203389
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||| ||||| | ||| | |||||||||||||||||||| |||| |||| |
|
|
| T |
43203306 |
gtctagaagtcctagatgaactggcaaatgccgaaattgtaaggcgggacgccgtgacccgggttcgaacccgggaccttacag |
43203389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 178
Target Start/End: Complemental strand, 32606459 - 32606386
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccg |
178 |
Q |
| |
|
||||||||||| ||| |||||||| ||||| ||||||||||||||||| ||||| |||||| |||||||||||| |
|
|
| T |
32606459 |
tgtctagaagttctaactcaactgacaaataccgaaattgcaaggccggacgtcgtgacccaggttcgaacccg |
32606386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 109 - 189
Target Start/End: Original strand, 8439081 - 8439161
Alignment:
| Q |
109 |
tagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||| || |||| |||||||| ||||||||| | ||||||||| |
|
|
| T |
8439081 |
tagaagtcctagttcaactggcaaatgccaaaattgcaaggtcggacgttgtgacccggattcgaacccaggacctcacag |
8439161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 5772947 - 5772864
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||| || || |||||||||||||||| || |||||||||| |
|
|
| T |
5772947 |
gtctagaagtcttagctcaacgggcaaatgccgaaattgcaaggtcggacaatgtgacccgggttcgaactcgaaacctcacag |
5772864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 15635007 - 15634924
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||| || | || ||||| |||||||| |||||| ||||||| |||||| |
|
|
| T |
15635007 |
gtctagaagtcatagctcaactagcaaatgccgaaattgtaaagtcggacgtcgtgacccggattcgaaaccggaacttcacag |
15634924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 106 - 177
Target Start/End: Original strand, 29255717 - 29255788
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||| | ||||| ||| |||||||||||||| |
|
|
| T |
29255717 |
gtctagaagttctagctcaactggcaaatgccaaaattgcaaggttggacgtcgtgatccgggttcgaaccc |
29255788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 106 - 168
Target Start/End: Original strand, 34763454 - 34763516
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccggg |
168 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||| || ||||| ||||||||| |
|
|
| T |
34763454 |
gtctagaagtcctagctcaactggaaaatgtcgaaattgcaagggcggacgtcgtgacccggg |
34763516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 135 - 189
Target Start/End: Complemental strand, 47570817 - 47570763
Alignment:
| Q |
135 |
gccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| | ||||||| |
|
|
| T |
47570817 |
gccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggatctcacag |
47570763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 124 - 177
Target Start/End: Original strand, 41183833 - 41183886
Alignment:
| Q |
124 |
aactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||| |||||||||||| |
|
|
| T |
41183833 |
aactggcaaatgccgaaattgcaaggccggacgtcttgacctgggttcgaaccc |
41183886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 35157209 - 35157141
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
35157209 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
35157141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 45236933 - 45237001
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
45236933 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
45237001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 105 - 185
Target Start/End: Complemental strand, 47961084 - 47961004
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctc |
185 |
Q |
| |
|
|||||||||||| || ||||||| ||||||||| ||||| ||||| | ||||||||| |||||||||||||||| ||||| |
|
|
| T |
47961084 |
tgtctagaagtcttaactcaacttgcaaatgccaaaattacaaggtcagacgtcatgaaccgggttcgaacccgggacctc |
47961004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 117 - 188
Target Start/End: Original strand, 5587291 - 5587362
Alignment:
| Q |
117 |
ctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||| || || ||| |||||||||||||| | |||||||| |
|
|
| T |
5587291 |
ctagctcaactgacaaatgccgaaattgcaagtccggacatcgtgatccgggttcgaacccaggacctcaca |
5587362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 117 - 188
Target Start/End: Original strand, 5592252 - 5592323
Alignment:
| Q |
117 |
ctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||| || || ||| |||||||||||||| | |||||||| |
|
|
| T |
5592252 |
ctagctcaactgacaaatgccgaaattgcaagtccggacatcgtgatccgggttcgaacccaggacctcaca |
5592323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 107 - 189
Target Start/End: Complemental strand, 42081743 - 42081662
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||| |||||||||| | |||||||||| ||||||| ||| ||||||||||||| || ||||||||| |
|
|
| T |
42081743 |
tctagaagtcctagctcagctggcaaatgtcaaaattgcaagatcgaacgttgtgatccgggttcgaacctgg-acctcacag |
42081662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 171
Target Start/End: Complemental strand, 43171068 - 43171002
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttc |
171 |
Q |
| |
|
|||||| |||||||| |||||||| ||||||||||||||||||||||| ||||| | |||| ||||| |
|
|
| T |
43171068 |
tgtctataagtcctaactcaactgacaaatgccgaaattgcaaggccggacgtcgtaacccaggttc |
43171002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 107 - 189
Target Start/End: Original strand, 48146754 - 48146836
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||| || |||||||||||| |||||| |||||||||||| | | ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
48146754 |
tctagaggttctagctcaactgaaaaatgcagaaattgcaaggtcagatgtcgtgacccgggttcgaacccgggacctcacag |
48146836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 121 - 178
Target Start/End: Original strand, 28603026 - 28603083
Alignment:
| Q |
121 |
ctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccg |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||| ||||| | ||||||||||| |
|
|
| T |
28603026 |
ctcaactggcaaatgccgaaatcgcaaggccggacgtcgtgacctgagttcgaacccg |
28603083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 1323686 - 1323754
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
1323686 |
agaagtcctagctcaactggcaaaatgccgaatttgttaggccggatgtcatgaccagggttcgaaccc |
1323754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 2354922 - 2354854
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | ||||||||| | |||||||||| |
|
|
| T |
2354922 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggagttcgaaccc |
2354854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 3497642 - 3497574
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
3497642 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
3497574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 7312578 - 7312510
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
7312578 |
agaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccc |
7312510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 9379994 - 9380062
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
9379994 |
agaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaaccc |
9380062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 35849298 - 35849366
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
35849298 |
agaagtcctagctcaactggcaaagtgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
35849366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 38033728 - 38033812
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||| |||| || || | ||| |||||||| || |||| ||||||||| |
|
|
| T |
38033728 |
tgtctagaagttctaactcaactggcaaatgccgaaattgtaaggtcggacattgtgatccgggttcaaatccgggacctcacag |
38033812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 40809048 - 40809116
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
40809048 |
agaagtcctagctcaactggcaaaatgccgaatttgttaggccggatgtcatgaccagggttcgaaccc |
40809116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 177
Target Start/End: Complemental strand, 48444281 - 48444209
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||| | | ||||| ||| | |||||||||||| |
|
|
| T |
48444281 |
tgtctagaagtcctagctcaactgaaaaatgccgaaattgtaagactggacgtcgtgatctgggttcgaaccc |
48444209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 48612520 - 48612588
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
48612520 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
48612588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 106 - 185
Target Start/End: Complemental strand, 4001970 - 4001891
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctc |
185 |
Q |
| |
|
||||||| ||| ||| ||||||| ||||| |||||||||||||||| | ||| |||||||||||||||| ||| ||||| |
|
|
| T |
4001970 |
gtctagatgtcatagtacaactggaaaatgtcgaaattgcaaggccggatgtcgtgacccgggttcgaactcgggacctc |
4001891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 11355823 - 11355906
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||| |||| |||||| |||||||||||||||||||| || |||| |||| | || ||||||||||| | ||||||| |
|
|
| T |
11355823 |
gtctagaagttctagttcaactaacaaatgccgaaattgcaaggtcggacgttatgatctggattcgaacccgggatctcacag |
11355906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 164
Target Start/End: Complemental strand, 27915710 - 27915651
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacc |
164 |
Q |
| |
|
||||||||||||||| ||||||||| |||||| |||||||||||| || ||||| ||||| |
|
|
| T |
27915710 |
tgtctagaagtcctaactcaactggtaaatgctgaaattgcaaggtcggacgtcgtgacc |
27915651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 177
Target Start/End: Complemental strand, 37410830 - 37410759
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||| |||||| | |||||||| |||||||||||| |
|
|
| T |
37410830 |
tctagaagtcttagctcaactggcaaaatgccgaaattgttaggccggatgtcatgactggggttcgaaccc |
37410759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 189
Target Start/End: Complemental strand, 38781304 - 38781253
Alignment:
| Q |
138 |
gaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||| ||| |||||||| ||||||||||| ||||||||| |
|
|
| T |
38781304 |
gaaattgcaaggccgaatgtcgtgacccggattcgaacccgggacctcacag |
38781253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 46427360 - 46427443
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||| |||| |||||||||||| ||||| | ||||||||||| | |||||||||| ||| |||||| |||||||||||||| |
|
|
| T |
46427360 |
gtctaaaagttctagctcaactgacaaatatcaaaattgcaaggttggacgtcatgactcggattcgaatccggaacctcacag |
46427443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 106 - 176
Target Start/End: Original strand, 25872763 - 25872833
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacc |
176 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||| ||| ||||| || ||||| ||| || |||||||||| |
|
|
| T |
25872763 |
gtctagaagtcctaactcaattggcaaatgccgatattacaaggtcggacgtcgtgatccaggttcgaacc |
25872833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 1573966 - 1573898
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
1573966 |
agaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
1573898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 4106557 - 4106625
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
4106557 |
agaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
4106625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 4887638 - 4887570
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| ||||||||||| |
|
|
| T |
4887638 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccc |
4887570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 18944927 - 18944995
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||| |||||| | |||||||| |||||||||||| |
|
|
| T |
18944927 |
agaagtcctagttcaactggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaaccc |
18944995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 19306715 - 19306783
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
19306715 |
agaagtcctagctcaactggcaaaatgccgaaattattaggccggatgccatgaccggggttcgaaccc |
19306783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 137 - 189
Target Start/End: Complemental strand, 39514080 - 39514028
Alignment:
| Q |
137 |
cgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| |||||||||||| |||| |||| |
|
|
| T |
39514080 |
cgaaattgcaaggccggacgtcgtgacccgagttcgaacccgggaccttacag |
39514028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 107 - 175
Target Start/End: Original strand, 1869815 - 1869885
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc--aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaac |
175 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |||||| | | ||||||| |||||||||| |
|
|
| T |
1869815 |
tctagaagtcctagctcaactggcaaaaatgccgatattgttaggccggatgccatgaccggggttcgaac |
1869885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 112 - 174
Target Start/End: Complemental strand, 10061139 - 10061076
Alignment:
| Q |
112 |
aagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaa |
174 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||| | | ||||||| ||||||||| |
|
|
| T |
10061139 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaa |
10061076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 17895638 - 17895705
Alignment:
| Q |
111 |
gaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
17895638 |
gaagtcctagctcaactggcaaaatgctgaaattgttaggccggatgccatgaccggggttcgaaccc |
17895705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 110 - 176
Target Start/End: Complemental strand, 31300122 - 31300055
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaacc |
176 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| | |||| | ||||||||| ||||||||||| |
|
|
| T |
31300122 |
agaagtcctagctaaactggcaaaatgccgaaattgttaagccggatgtcatgaccggggttcgaacc |
31300055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 107 - 177
Target Start/End: Complemental strand, 40656238 - 40656165
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc---aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
40656238 |
tctagaagtcctagctcaactggcaaaaaatgccgatattgttaggccggatgccatgaccggggttcgaaccc |
40656165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 177
Target Start/End: Original strand, 21226070 - 21226136
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
21226070 |
aagtcctatctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
21226136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 175
Target Start/End: Original strand, 31717300 - 31717366
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaac |
175 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| |||||| | | ||||||| |||||||||| |
|
|
| T |
31717300 |
agaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaac |
31717366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 107 - 144
Target Start/End: Complemental strand, 36280053 - 36280015
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc-aaatgccgaaattg |
144 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36280053 |
tctagaagtcctagctcaactggcaaaatgccgaaattg |
36280015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 110 - 174
Target Start/End: Complemental strand, 2228205 - 2228140
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaa |
174 |
Q |
| |
|
||||||| ||||||||||||| ||||| |||||||| |||||| | ||||||||| ||||||||| |
|
|
| T |
2228205 |
agaagtcgtagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaa |
2228140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 110 - 174
Target Start/End: Original strand, 6596545 - 6596610
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaa |
174 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||| |||||| | | ||||||| ||||||||| |
|
|
| T |
6596545 |
agaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaa |
6596610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 107 - 177
Target Start/End: Complemental strand, 23789542 - 23789470
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc--aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| |||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
23789542 |
tctagaagtcctagttcaactggcaaaaatgccgatattgttaggccggatgccatgaccggggttcgaaccc |
23789470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 107 - 177
Target Start/End: Original strand, 34708673 - 34708745
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc--aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |||| | | | ||||||| |||||||||||| |
|
|
| T |
34708673 |
tctagaagtcctagctcaactggcaaaaatgccgatattgttaggctggatgccatgaccggggttcgaaccc |
34708745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 107 - 177
Target Start/End: Complemental strand, 43133232 - 43133160
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggcaaa--tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||| |||||||||||||| ||||||| | ||||||||| |||| ||| ||||||||| |||||||||||| |
|
|
| T |
43133232 |
tctacaagtcctagctcaaatggcaaaaataccgaaattgttaggctgaatgtcatgaccggggttcgaaccc |
43133160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 110 - 162
Target Start/End: Complemental strand, 48729809 - 48729756
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatga |
162 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | ||||||| |
|
|
| T |
48729809 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatga |
48729756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 4069241 - 4069173
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||| |||||||||| |||| ||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
4069241 |
agaagtcctaactcaactggcaaaataccgaaattgttaggccggatgccatgaccggggttcgaaccc |
4069173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 118 - 177
Target Start/End: Original strand, 5508696 - 5508756
Alignment:
| Q |
118 |
tagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
5508696 |
tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
5508756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 37 - 103
Target Start/End: Original strand, 19736215 - 19736278
Alignment:
| Q |
37 |
tgaattaaacatgactttggagtaatttatttcaatcataaactacatgcacgaataactaatatat |
103 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| |||||||||| ||||| || ||||||| |
|
|
| T |
19736215 |
tgaattaaacatg---ttggagtaatgtatttcaatcaccaactacatgctcgaatcaccaatatat |
19736278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 27396439 - 27396371
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||| |||||||||||| |
|
|
| T |
27396439 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgattggggttcgaaccc |
27396371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 32251460 - 32251392
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||| | | || | ||||||||| |||||||||||| |
|
|
| T |
32251460 |
agaagtcctagttcaactggcaaaatgccgaaattgttaagtcggatgtcatgaccggggttcgaaccc |
32251392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 33628031 - 33628099
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| | |||| | | ||||||| |||||||||||| |
|
|
| T |
33628031 |
agaagtcctagctcaactgacaaagtgccgaaattgttaagccggatgccatgaccagggttcgaaccc |
33628099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 46021555 - 46021488
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaa--tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
46021555 |
aagtcctagctcaactgataaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
46021488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 47584796 - 47584728
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||| ||| |||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
47584796 |
agaagtcctagctcaactggcaaaatgtcgacattgttaggccggatgccatgaccggggttcgaaccc |
47584728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 75)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 4601425 - 4601508
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4601425 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccggaacctcacag |
4601508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 7824583 - 7824499
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7824583 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacag |
7824499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 29689611 - 29689527
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29689611 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacag |
29689527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 54151809 - 54151726
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54151809 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacag |
54151726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 54158266 - 54158349
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
54158266 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgatccgggttcgaacccgggacctcacag |
54158349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 51666053 - 51665970
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||| |||| |
|
|
| T |
51666053 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacctgggttcgaacccgggaccttacag |
51665970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 106 - 188
Target Start/End: Original strand, 1778851 - 1778933
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| || | ||||||||||||||||||||||||||||| |
|
|
| T |
1778851 |
gtctagaagtcctagctcaactgacaaatgccgaaattgcaaggccggacattgtgacccgggttcgaacccggaacctcaca |
1778933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 106 - 188
Target Start/End: Complemental strand, 42392933 - 42392851
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||| |||||||||| |||||||| |
|
|
| T |
42392933 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggtcggacgtcatgatccgggctcgaacccgggacctcaca |
42392851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 28844503 - 28844587
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||| |||| ||||||||||||||||| |||||||||||| |
|
|
| T |
28844503 |
tgtctagaagttctagctcaactgacaaatgccgaaattgcaaggccggacgttgtgacccgggttcgaacctggaacctcacag |
28844587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 55018163 - 55018079
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | |||||||||||||| ||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
55018163 |
tgtctagaagtcctaactcaactggcaaatgtcaaaattgcaaggccggacgtcgtgacccgggttcgaacccgggacctcacag |
55018079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 35461607 - 35461524
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| || |||| ||| |||||||||||||||||||||||||| |
|
|
| T |
35461607 |
gtctagaagttctagctcaactggcaaatgccgaaattgcaaggtcggacgttgtgatccgggttcgaacccggaacctcacag |
35461524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 118 - 189
Target Start/End: Complemental strand, 36229110 - 36229039
Alignment:
| Q |
118 |
tagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
36229110 |
tagctcaactggcaaatgccgaaattgcaaggccggacgtcatgatccgggttcgaacccgggacctcacag |
36229039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 43247778 - 43247695
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||| |||||||||||||| ||||||||| |
|
|
| T |
43247778 |
gtctagaagtcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaacccgggacctcacag |
43247695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 52500838 - 52500921
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||| ||||||||| ||||||||||||| | |||||||||| |
|
|
| T |
52500838 |
gtctagaagtcctagctcaactggcaaatgtcgaaattgtaaggccggacgtcatgatccgggttcgaacctgaaacctcacag |
52500921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 106 - 187
Target Start/End: Original strand, 41377584 - 41377665
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcac |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||||| ||||||||| || ||||||||||||| ||||||| |
|
|
| T |
41377584 |
gtctagaagtcctagctcaactggcaaatgccaaaattgtaaggccggacgtcatgatccaggttcgaacccgggacctcac |
41377665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 51112588 - 51112521
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |||||||||||| |
|
|
| T |
51112588 |
agaagtcctagctcaactggcaaatgccgaaattgctaggccggacgtcatgaccggggttcgaaccc |
51112521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 33334607 - 33334691
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||| |||| ||||| | ||||||| |||| ||||||||| |
|
|
| T |
33334607 |
tgtctagaagtcctagctcaacttgcaaatgccgaaattgcaaagccggacgttgtgacctgagttcgaatccgggacctcacag |
33334691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 118 - 189
Target Start/End: Complemental strand, 3113111 - 3113040
Alignment:
| Q |
118 |
tagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| | ||||| |||||||||||| | ||||||| |
|
|
| T |
3113111 |
tagctcaactggcaaatgccgaaattgcaaggccggacgtcgtaacccgagttcgaacccgggatctcacag |
3113040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 122 - 189
Target Start/End: Complemental strand, 9349788 - 9349721
Alignment:
| Q |
122 |
tcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||| ||| |||||||||||||||| ||||||||| |
|
|
| T |
9349788 |
tcaactggcaaatgccgaaattgcaaggtcggacgtcgtgatccgggttcgaacccgggacctcacag |
9349721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 22 - 105
Target Start/End: Original strand, 20002036 - 20002119
Alignment:
| Q |
22 |
tttctctcatggtcatgaattaaacatgactttggagtaatttatttcaatcataaactacatgcacgaataactaatatatct |
105 |
Q |
| |
|
||||||||||| |||||||||||||||||| || ||||||| ||||||||||| |||||||||||| ||| || ||||||||| |
|
|
| T |
20002036 |
tttctctcatgctcatgaattaaacatgacattagagtaatgtatttcaatcacaaactacatgcatgaaccaccaatatatct |
20002119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 112 - 189
Target Start/End: Complemental strand, 475402 - 475325
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||| ||| |||||||| |||||| |||||||||||| || ||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
475402 |
aagtcttagatcaactgggaaatgctgaaattgcaaggtcggacgtcatgatccgggttcgaactcggaacctcacag |
475325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 106 - 175
Target Start/End: Original strand, 29750621 - 29750690
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaac |
175 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||||||| | ||||| |||||||| ||||||| |
|
|
| T |
29750621 |
gtctagaagtactaactcaactggcaaatgccgaaattgcaaggctggacgtcgtgacccggattcgaac |
29750690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 106 - 175
Target Start/End: Complemental strand, 32001552 - 32001483
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaac |
175 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||| |||||||||| || ||| || ||||||||| |
|
|
| T |
32001552 |
gtctagaagtcctacctcaactggtaaatgccgaaattgtaaggccgaacatcttgaaccaggttcgaac |
32001483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 107 - 187
Target Start/End: Complemental strand, 2590928 - 2590848
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcac |
187 |
Q |
| |
|
|||| |||||||| ||||||||| ||||| ||||||||||||||||||| || ||| | |||||||||||| | ||||||| |
|
|
| T |
2590928 |
tctataagtcctaactcaactggaaaatgtcgaaattgcaaggccgaacatcgtgatctgggttcgaaccctggacctcac |
2590848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 3917769 - 3917837
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
3917769 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
3917837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 188
Target Start/End: Original strand, 31255406 - 31255488
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
|||||||||||||| |||||||| |||||| ||||||| || || | ||||| |||||||||||||||||||| ||||||| |
|
|
| T |
31255406 |
gtctagaagtcctaactcaactgacaaatgtcgaaattataaagctggacgtcgtgacccgggttcgaacccgggtcctcaca |
31255488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 4232302 - 4232234
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
4232302 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
4232234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 4833234 - 4833166
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
4833234 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
4833166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 8381082 - 8381150
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
8381082 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
8381150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 13525172 - 13525240
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
13525172 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
13525240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 185
Target Start/End: Original strand, 27396857 - 27396933
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctc |
185 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| |||||| | | ||||||| |||||||||||||| ||||| |
|
|
| T |
27396857 |
agaagtcctagctcaactgacaaaatgccgaaattgttaggccggatgccatgaccggggttcgaacccggtacctc |
27396933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 28458662 - 28458745
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||| |||||||| |||||| ||||||||||||||| | ||| ||| || |||| |||||| ||||||||||| |
|
|
| T |
28458662 |
tgtctagaagtcctaactcaactgacaaatgtcgaaattgcaaggccagatgtcgtgatcc-ggtttgaacccagaacctcacag |
28458745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 109 - 165
Target Start/End: Complemental strand, 45686152 - 45686096
Alignment:
| Q |
109 |
tagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgaccc |
165 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||| ||||||| ||||| |||||| |
|
|
| T |
45686152 |
tagaagtcttagctcaactagcaaatgccgaaattgaaaggccggacgtcgtgaccc |
45686096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 107 - 175
Target Start/End: Original strand, 51054702 - 51054770
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaac |
175 |
Q |
| |
|
||||||||||||| |||||||| |||||| ||||||| ||||| ||||||| |||| ||||||||||| |
|
|
| T |
51054702 |
tctagaagtcctaactcaactgacaaatgtcgaaattacaaggtcgaacgttatgattcgggttcgaac |
51054770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 177
Target Start/End: Original strand, 11312590 - 11312661
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||| | | |||||| |||||||||||| |
|
|
| T |
11312590 |
tctagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccc |
11312661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 42296715 - 42296782
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
42296715 |
agaagtcctagctcaactgcaaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccc |
42296782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 110 - 144
Target Start/End: Complemental strand, 14868979 - 14868945
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaatgccgaaattg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
14868979 |
agaagtcctagctcaactggcaaatgccgaaattg |
14868945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 112 - 177
Target Start/End: Original strand, 24751758 - 24751824
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||| | ||||||| | |||||||||||| |
|
|
| T |
24751758 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccc |
24751824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 28171105 - 28171036
Alignment:
| Q |
110 |
agaagtcctagctcaactggc--aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
28171105 |
agaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
28171036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 29212188 - 29212122
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
29212188 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
29212122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 40840171 - 40840240
Alignment:
| Q |
110 |
agaagtcctagctcaactggc--aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
40840171 |
agaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
40840240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 2687562 - 2687630
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||| | |||||||||||| |
|
|
| T |
2687562 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatggcatgatcggggttcgaaccc |
2687630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 4976833 - 4976765
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
4976833 |
agaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaaccc |
4976765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 6583360 - 6583292
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||| | |||||||||||| |
|
|
| T |
6583360 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccc |
6583292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 10228960 - 10229028
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||| || ||||||||||||| |||| |||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
10228960 |
agaagtcttaactcaactggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccc |
10229028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 24650672 - 24650604
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
24650672 |
agaagtcctacctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
24650604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 32961103 - 32961035
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||| | | ||||||| |||||||||||| |
|
|
| T |
32961103 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccagatgccatgaccggggttcgaaccc |
32961035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 34397683 - 34397751
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||| |||||| | ||||| ||| |||||||||||| |
|
|
| T |
34397683 |
agaagtcctagttcaactggcaaaatgccgaaattgttaggccggatgtcataaccggggttcgaaccc |
34397751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 40756856 - 40756772
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacg-tcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||| |||||||| ||||||| ||||||||||| | ||| |||||| |||| |||||||||| ||||||||| |
|
|
| T |
40756856 |
gtctagaagtcctaactcaactgaaaaatgccaaaattgcaaggtcagacgatcatgatccggattcgaacccgagacctcacag |
40756772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 41464667 - 41464735
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| || | | ||||||| |||||||||||| |
|
|
| T |
41464667 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaaccc |
41464735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 43775222 - 43775306
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||| |||| ||| |||||||||||||||||||||||| |||| || |||| |||| | ||||||| |||||| ||||||| |
|
|
| T |
43775222 |
tgtctaaaagttctaactcaactggcaaatgccgaaattgtaaggtcggacgttgtgacttgcgttcgaatccggaatctcacag |
43775306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 47410877 - 47410809
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| ||| || | ||||||||| |||||||||||| |
|
|
| T |
47410877 |
agaagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgtcatgaccggggttcgaaccc |
47410809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 107 - 177
Target Start/End: Original strand, 1242217 - 1242288
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||| | | ||||| | |||||||||||| |
|
|
| T |
1242217 |
tctagaagtcctagctcaactggcaaaatgccgaaattattaggccggatgccatgatcggggttcgaaccc |
1242288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 7958569 - 7958652
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||| |||||||| |||||| | |||||| || || | | | | ||| |||||||||||||||| ||||||||| |
|
|
| T |
7958569 |
gtctagaagtcctacctcaactgacaaatgtcaaaattgtaaagcaggatgccgtgatccgggttcgaacccgggacctcacag |
7958652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 110 - 176
Target Start/End: Original strand, 22371453 - 22371520
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaacc |
176 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||| |||||| | | ||||||| ||||||||||| |
|
|
| T |
22371453 |
agaagtcctacctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaacc |
22371520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 110 - 176
Target Start/End: Original strand, 37124219 - 37124286
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaacc |
176 |
Q |
| |
|
||||||| |||||| ||||||||| ||||||||||| |||||||| | ||||||| ||||||||||| |
|
|
| T |
37124219 |
agaagtcatagctctactggcaaaatgccgaaattgttaggccgaatgccatgaccggggttcgaacc |
37124286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 137 - 188
Target Start/End: Complemental strand, 38257400 - 38257349
Alignment:
| Q |
137 |
cgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
||||||||||||| || ||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
38257400 |
cgaaattgcaaggtcggacgtcgtgacctgggttcgaacccagaacctcaca |
38257349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 106 - 149
Target Start/End: Original strand, 50729524 - 50729567
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaagg |
149 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||| |||| |
|
|
| T |
50729524 |
gtctagaagttctagctcaactgacaaatgccgaaattgtaagg |
50729567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 106 - 149
Target Start/End: Complemental strand, 50783325 - 50783282
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaagg |
149 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||| |||| |
|
|
| T |
50783325 |
gtctagaagttctagctcaactgacaaatgccgaaattgtaagg |
50783282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 10474037 - 10473971
Alignment:
| Q |
112 |
aagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
10474037 |
aagtcctagctcaactggcaaaatgctgaaattgttaggccggatgccatgaccggggttcgaaccc |
10473971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 47069009 - 47069078
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa--tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
47069009 |
agaagtcttagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
47069078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 175
Target Start/End: Original strand, 48191097 - 48191163
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaac |
175 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| |||||| | ||||||||| |||||||||| |
|
|
| T |
48191097 |
agaagtcctagctcaactgctaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaac |
48191163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 109 - 162
Target Start/End: Complemental strand, 31305868 - 31305815
Alignment:
| Q |
109 |
tagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatga |
162 |
Q |
| |
|
|||||||| |||||||| ||||||||| ||||||||||||| |||| |||||| |
|
|
| T |
31305868 |
tagaagtcttagctcaattggcaaatgtcgaaattgcaaggtagaacatcatga |
31305815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 189
Target Start/End: Complemental strand, 8137748 - 8137676
Alignment:
| Q |
117 |
ctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| || ||||||||||||| ||| ||| | | |||||||||| |
|
|
| T |
8137748 |
ctagctcaactaacaaatgcaaaaattgcaaggtcggacgtcatgacccgagtttgaatctgaaacctcacag |
8137676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 177
Target Start/End: Original strand, 11751216 - 11751283
Alignment:
| Q |
112 |
aagtcctagctcaactggc--aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||| | | ||| ||| |||||||||||| |
|
|
| T |
11751216 |
aagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatcaccggggttcgaaccc |
11751283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 15003631 - 15003699
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||| ||||||||| ||||||| |||||| ||| || | ||||||||| |||||||||||| |
|
|
| T |
15003631 |
agaagtcctagttcaactggcaaaatgccaaaattgttaggtcggatgtcatgaccggggttcgaaccc |
15003699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 24250728 - 24250796
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| |||||| | | |||||| |||||||||||| |
|
|
| T |
24250728 |
agaagtcctagctcaattggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccc |
24250796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 24910413 - 24910345
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||| | | |||||| | |||||||||||| |
|
|
| T |
24910413 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggctggatatcatgatcggggttcgaaccc |
24910345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 27002865 - 27002797
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| | |||| | | ||||||| | |||||||||| |
|
|
| T |
27002865 |
agaagtcctagctcaactggcaaagtgccgaaattgttaagccggatgccatgaccagagttcgaaccc |
27002797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 30553093 - 30553025
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| || ||| | | ||||||| | |||||||||| |
|
|
| T |
30553093 |
agaagtcctagctcaactggcaaaatgccgaaattgttagaccggatgccatgaccggagttcgaaccc |
30553025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 35069316 - 35069384
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||| ||| |||||||||||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
35069316 |
agaagtcttagttcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
35069384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 38127967 - 38127899
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| |||||| | | |||||| |||||||||||| |
|
|
| T |
38127967 |
agaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgctatgaccggggttcgaaccc |
38127899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 43605701 - 43605633
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||| ||| ||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
43605701 |
agaagtcctagctcaactggcaaaatgctgaatttgttaggccggatgccatgaccggggttcgaaccc |
43605633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 174
Target Start/End: Original strand, 47770329 - 47770393
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaa |
174 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||| || ||||| ||||| || |||||| |
|
|
| T |
47770329 |
agaagtcctagctcaactgataaatgtcgaaattgcaagctcggacgtcgtgacctggattcgaa |
47770393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 54097565 - 54097497
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| |||||| | | ||||||| ||||| |||||| |
|
|
| T |
54097565 |
agaagtcctagctcaaatggcaaaatgccgaaattgttaggccggatgccatgaccggggttggaaccc |
54097497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 69)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 41808202 - 41808285
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41808202 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccggaacctcacag |
41808285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 32007074 - 32007157
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32007074 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacag |
32007157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 5055916 - 5055833
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5055916 |
gtctagaagtcctagctcagctggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacag |
5055833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 48660021 - 48660105
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| | ||||||| |
|
|
| T |
48660021 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgttatgacccgggttcgaacccgggatctcacag |
48660105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 28455874 - 28455957
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
28455874 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgttgtgacccgggttcgaacccgggacctcacag |
28455957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 109 - 188
Target Start/End: Original strand, 29587255 - 29587334
Alignment:
| Q |
109 |
tagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
29587255 |
tagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcgtgacctgggttcgaacccgggacctcaca |
29587334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 106 - 188
Target Start/End: Complemental strand, 29994511 - 29994429
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |||||||| |
|
|
| T |
29994511 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccagacgtcatgatccgggttcgaacccgagacctcaca |
29994429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 113 - 189
Target Start/End: Original strand, 39276357 - 39276433
Alignment:
| Q |
113 |
agtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
39276357 |
agtcctagctcaactggcaaatgccgaaattgcaaggccggacgttgtgacccgggttcgaacccgggacctcacag |
39276433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 41761540 - 41761456
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||||||||||||||||| | ||||||||| |
|
|
| T |
41761540 |
tgtctagaagtcctagttcaactggcaaatgccgaaattgcaaggccggacgttgtgacccgggttcgaacccaggacctcacag |
41761456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 45813140 - 45813056
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| || || || |||||||||||||||||||| ||||||||| |
|
|
| T |
45813140 |
tgtctagaagtcctagctcaactgacaaatgccgaaattgcaaggtcggacatcgtgacccgggttcgaacccgggacctcacag |
45813056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 49783706 - 49783790
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||| |||||||| ||||| ||||||||| ||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49783706 |
tgtctataagtcctaactcaattggcaaatgtcgaaattgcaaggtcgaacgtcatgattcgggttcgaacccggaacctcacag |
49783790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 20748 - 20831
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| | ||| | |||||||| ||||||||||| ||||||||| |
|
|
| T |
20748 |
gtctagaagtcctaactcaactggcaaatgccgaaattgcaaggcaggacgccgtgacccggattcgaacccgggacctcacag |
20831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 107 - 189
Target Start/End: Original strand, 5943682 - 5943764
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||||| | | ||||||||| |
|
|
| T |
5943682 |
tctagaattcctagctcaactgacaaatgccgaaattgcaaggccggacgtcgtgacccgggttcgaactcaggacctcacag |
5943764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 107 - 189
Target Start/End: Original strand, 35945798 - 35945880
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||| | |||| ||||| |||||||||||||||||||||||| |
|
|
| T |
35945798 |
tctagaagtcctagctcaactggtaaatgccgaaattgtaaggctggacgttgtgacctgggttcgaacccggaacctcacag |
35945880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 105 - 174
Target Start/End: Original strand, 45294657 - 45294726
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaa |
174 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||| || |||||||||||||||||| |
|
|
| T |
45294657 |
tgtctagaagtcctagctcaactagcaaatgccgaaattgcaagaccggacatcatgacccgggttcgaa |
45294726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 46447506 - 46447422
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||| ||||| | |||||||||||||||||| ||||||||| |
|
|
| T |
46447506 |
tgtctagaagttctagttcaactggcaaatgccgaaattgcaaggctcgacgtcgtaacccgggttcgaacccgggacctcacag |
46447422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 108 - 189
Target Start/End: Original strand, 21938944 - 21939025
Alignment:
| Q |
108 |
ctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||| | ||||||| |||| |||||| || | ||||||||| |
|
|
| T |
21938944 |
ctagaagtcctagctcaactggtaaatgccgaaattgtaaggccggatgtcatgatccggattcgaatccaggacctcacag |
21939025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 50106325 - 50106241
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||| | |||||| ||||| || ||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
50106325 |
tgtctagaagtcctaatttaactggtaaatgttgagattgcaaggccgaacgttgtgacccgggttcgaacccgggacctcacag |
50106241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 192415 - 192498
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||| |||| ||| ||| |||||||||| | ||||||||| |
|
|
| T |
192415 |
gtctagaagtcctagctcaactgacaaatgctaaaattgcaaggccggacgttgtgatccgtgttcgaacccaggacctcacag |
192498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 122 - 189
Target Start/End: Original strand, 35224356 - 35224423
Alignment:
| Q |
122 |
tcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||| ||| |||||||||| |||||||||||||||||||||||| | ||||||||| |
|
|
| T |
35224356 |
tcaactggcaaatgcgaaaaatgcaaggccggacgtcatgacccgggttcgaacccaggacctcacag |
35224423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 7204632 - 7204565
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaa--tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||| |||||||| |||||||||||| |
|
|
| T |
7204632 |
aagtcctagctcaactggcaaaaatgccgaaattgttaggccgaacatcatgaccggggttcgaaccc |
7204565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 7275680 - 7275764
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||| || || ||||||||||||||| |||||||| |||| || |||| ||||| ||| |||||||||||||| |||||| |
|
|
| T |
7275680 |
tgtctagaaatcttaactcaactggcaaatgtcgaaattgtaaggtcggacgttatgactcggattcgaacccggaacttcacag |
7275764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 106 - 174
Target Start/End: Original strand, 11688263 - 11688331
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaa |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||| |||||||| |||||| |||||||| |
|
|
| T |
11688263 |
gtctagaagtcctagctcaactgacaaatatcgaaattgcaagcccgaacgttgtgaccctggttcgaa |
11688331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 24119659 - 24119727
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
24119659 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
24119727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 26032798 - 26032884
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaag---gccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||| ||| | || ||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
26032798 |
gtctagaagtcctaattcaactgacaaatgccgaaattgtaaggtcggcggacgtcgtgacccgggttcgaacctggaacctcacag |
26032884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 48314170 - 48314238
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
48314170 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
48314238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 22 - 105
Target Start/End: Original strand, 17633215 - 17633296
Alignment:
| Q |
22 |
tttctctcatggtcatgaattaaacatgactttggagtaatttatttcaatcataaactacatgcacgaataactaatatatct |
105 |
Q |
| |
|
||||||||||||||||||| |||||| | ||| |||||||| |||||| ||| ||||||||||||| |||||||||||||||| |
|
|
| T |
17633215 |
tttctctcatggtcatgaactaaacacaattttagagtaatt-atttca-tcacaaactacatgcacaaataactaatatatct |
17633296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 188
Target Start/End: Complemental strand, 2089033 - 2088951
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||| | || || |||| ||||||||||| | |||||||||| |
|
|
| T |
2089033 |
gtctagaagtcctagctcaactggcaaatatcgaaattgtaaggtcagacatcgtgactcgggttcgaactcagaacctcaca |
2088951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 105 - 174
Target Start/End: Original strand, 4065960 - 4066029
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaa |
174 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||||||||||| | |||||| ||| ||||||||||| |
|
|
| T |
4065960 |
tgtctagaagacctagctcaactgacaaataccgaaattgcaagactgaacgttgtgatccgggttcgaa |
4066029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 10635492 - 10635560
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
10635492 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
10635560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 13555849 - 13555781
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
13555849 |
agaagtcctagctcaactggcaaaatgccgaaattattaggccggatgtcatgaccggggttcgaaccc |
13555781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 19338303 - 19338235
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
19338303 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
19338235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 29005093 - 29005161
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
29005093 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
29005161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 43676149 - 43676081
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
43676149 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
43676081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 48391959 - 48392027
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
48391959 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccagggttcgaaccc |
48392027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 106 - 169
Target Start/End: Complemental strand, 25931277 - 25931214
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggt |
169 |
Q |
| |
|
|||||||| ||||| |||||||| ||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
25931277 |
gtctagaaatcctaactcaactgacaaatgccgaaattgcaaggctagacgtcgtgacccgggt |
25931214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 118 - 177
Target Start/End: Original strand, 47111469 - 47111528
Alignment:
| Q |
118 |
tagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || ||||| ||||| ||||| |||||| |
|
|
| T |
47111469 |
tagctcaactgacaaatgccgaaattgcaaggtcggacgtcgtgacctgggtttgaaccc |
47111528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 270447 - 270378
Alignment:
| Q |
110 |
agaagtcctagctcaactggc--aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
270447 |
agaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
270378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 110 - 174
Target Start/End: Original strand, 5790061 - 5790126
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaa |
174 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| |||||| | ||||||||| ||||||||| |
|
|
| T |
5790061 |
agaagtcctagcttaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaa |
5790126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 112 - 161
Target Start/End: Complemental strand, 16770278 - 16770229
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatg |
161 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| || |||||||| |
|
|
| T |
16770278 |
aagtcttagctcaactggcaaatgccgaaattgtaaggtcggacgtcatg |
16770229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 105 - 166
Target Start/End: Complemental strand, 32982479 - 32982418
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccg |
166 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| || |||||| ||| | |||||||| |
|
|
| T |
32982479 |
tgtctagaagtcctagctcaactgataaatgccgaaactgtaaggccaaactttatgacccg |
32982418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 177
Target Start/End: Original strand, 39606404 - 39606476
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc--aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
39606404 |
tctagaagtcctagctcaactggcaaaaatgccgatattgttaggccggatgccatgaccggggttcgaaccc |
39606476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 110 - 174
Target Start/End: Complemental strand, 40958699 - 40958634
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaa |
174 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| ||||||||| |
|
|
| T |
40958699 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaa |
40958634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 29511111 - 29511179
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||| ||| ||| || |||||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
29511111 |
agaagtcctagctcaattggtaaaatgacgaaattgttaggccgaatgtcatgaccggggttcgaaccc |
29511179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 169
Target Start/End: Complemental strand, 40809338 - 40809278
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggt |
169 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | ||||||||| |||| |
|
|
| T |
40809338 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggt |
40809278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 42631110 - 42631042
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||| | |||||||||||| |
|
|
| T |
42631110 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccc |
42631042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 109 - 176
Target Start/End: Original strand, 778578 - 778644
Alignment:
| Q |
109 |
tagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacc |
176 |
Q |
| |
|
||||||| ||||||||||||| |||||||| |||| ||||| |||||||| |||| | |||||||||| |
|
|
| T |
778578 |
tagaagttctagctcaactggaaaatgccg-aattacaaggtcgaacgtcgtgactcaggttcgaacc |
778644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 107 - 177
Target Start/End: Original strand, 15104044 - 15104115
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| |||||| |||||| | ||||||| | |||||||||||| |
|
|
| T |
15104044 |
tctagaagtcctagctcaactgacaaaatgccaaaattgttaggccggatgtcatgatcggggttcgaaccc |
15104115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 115 - 177
Target Start/End: Complemental strand, 20164193 - 20164130
Alignment:
| Q |
115 |
tcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
20164193 |
tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
20164130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 107 - 177
Target Start/End: Original strand, 21522317 - 21522388
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||| ||| || | | ||||||| |||||||||||| |
|
|
| T |
21522317 |
tctagaagtcctagctcaattggcaaagtgccgaaattgttaggtcggatgccatgaccggggttcgaaccc |
21522388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 107 - 177
Target Start/End: Complemental strand, 32880707 - 32880636
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||| |||||| | | |||||| |||||||||||| |
|
|
| T |
32880707 |
tctagaagtcctaactcaactggcaaaatgccgaaattgttaggccggatgccatgactggggttcgaaccc |
32880636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 107 - 177
Target Start/End: Complemental strand, 48731884 - 48731813
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||| ||||| | | ||||||| |||||||||||| |
|
|
| T |
48731884 |
tctagaagtcctagctcaactgacaaaatgccgaaattgttaggccagatgccatgaccggggttcgaaccc |
48731813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 189
Target Start/End: Original strand, 3716636 - 3716694
Alignment:
| Q |
131 |
aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||| || ||| | ||||||||||| |
|
|
| T |
3716636 |
aaatgtcgaaattgcaaggccgaacgtcatgatccggatttaaactcagaacctcacag |
3716694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 175
Target Start/End: Original strand, 40685532 - 40685598
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaac |
175 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| ||| || | ||||||||| |||||||||| |
|
|
| T |
40685532 |
agaagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgtcatgaccggggttcgaac |
40685598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 43086594 - 43086528
Alignment:
| Q |
112 |
aagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||| | | ||||| | |||||||||||| |
|
|
| T |
43086594 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccc |
43086528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 177
Target Start/End: Original strand, 49500866 - 49500932
Alignment:
| Q |
112 |
aagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||| | ||||||| | ||||||||||| |
|
|
| T |
49500866 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcgaggttcgaaccc |
49500932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 79
Target Start/End: Original strand, 12139589 - 12139642
Alignment:
| Q |
26 |
tctcatggtcatgaattaaacatgactttggagtaatttatttcaatcataaac |
79 |
Q |
| |
|
||||||| | ||||| |||||| |||||||||||||| ||||||||||| |||| |
|
|
| T |
12139589 |
tctcatgcttatgaactaaacaagactttggagtaatgtatttcaatcacaaac |
12139642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 3315797 - 3315865
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||| |||||| | | ||||||| || ||||||||| |
|
|
| T |
3315797 |
agaagtcctagctcaactggcaaaatgccgacattgttaggccggatgccatgaccaggattcgaaccc |
3315865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 5598304 - 5598372
Alignment:
| Q |
110 |
agaagtcctagctcaactgg-caaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| || | ||||||||| | |||||||||| |
|
|
| T |
5598304 |
agaagtcctagctcaactggaaaaatgccgaaattgttaggtcggatgtcatgaccggagttcgaaccc |
5598372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 175
Target Start/End: Complemental strand, 11797522 - 11797458
Alignment:
| Q |
112 |
aagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaac |
175 |
Q |
| |
|
|||||||| |||||||||| ||||| |||||||| |||||||| ||||||||| || ||||||| |
|
|
| T |
11797522 |
aagtcctaactcaactggcaaaatgtcgaaattgttaggccgaatgtcatgaccgggattcgaac |
11797458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 13018076 - 13018144
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||| || ||| | | ||||||| |||||||||||| |
|
|
| T |
13018076 |
agaagtcttagctcaactggcaaagtgccgaaattgttagaccggatgccatgaccggggttcgaaccc |
13018144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 17068155 - 17068223
Alignment:
| Q |
110 |
agaagtcctagctcaactgg-caaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||| | | ||||| | |||||||||||| |
|
|
| T |
17068155 |
agaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgagcggggttcgaaccc |
17068223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 17540200 - 17540133
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaa--tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||||| ||||| ||||||||||| |||||||||||| |
|
|
| T |
17540200 |
aagtcctagctcaactagtaaaaatgccgaaattgttaggccagacgtcatgaccggggttcgaaccc |
17540133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 18089893 - 18089825
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||| ||| ||||||| |||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
18089893 |
agaagtcttagttcaactgacaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
18089825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 177
Target Start/End: Original strand, 27078559 - 27078619
Alignment:
| Q |
117 |
ctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||| ||||| |||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
27078559 |
ctagctcaactgcaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaaccc |
27078619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 144
Target Start/End: Original strand, 28689591 - 28689623
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaatgccgaaattg |
144 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
28689591 |
aagtccaagctcaactggcaaatgccgaaattg |
28689623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 176
Target Start/End: Original strand, 39284288 - 39284360
Alignment:
| Q |
104 |
ctgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacc |
176 |
Q |
| |
|
||||||||||||| ||||||||||| | |||| ||||||| |||| || ||||| ||| |||||||||||| |
|
|
| T |
39284288 |
ctgtctagaagtcatagctcaactgacgaatgttgaaattgtaaggtcggacgtcgtgattcgggttcgaacc |
39284360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 41445155 - 41445087
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||| |||||| | ||||||| | | |||||||||| |
|
|
| T |
41445155 |
agaagtcctagctcaactggcaaaatgccgacattgttaggccggatgtcatgatcggagttcgaaccc |
41445087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 49948244 - 49948312
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| |||||| | | ||||||| || ||||||||| |
|
|
| T |
49948244 |
agaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccgggattcgaaccc |
49948312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 77; Significance: 6e-36; HSPs: 44)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 33621493 - 33621577
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33621493 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacag |
33621577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 33704216 - 33704299
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33704216 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacag |
33704299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 106 - 188
Target Start/End: Original strand, 21000692 - 21000774
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
21000692 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgtacgtcatgacctgggttcgaacccgggacctcaca |
21000774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 106 - 188
Target Start/End: Original strand, 28322932 - 28323014
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
28322932 |
gtctagaagtcctagctcaactggcaaatgccgaaattgtaaggccggacgtcatgatccgggttcgaacccgggacctcaca |
28323014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 361010 - 361094
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| ||||||||||||||||| || |||| ||||||||||||||||||||||||| |
|
|
| T |
361010 |
tgtctagaagtcttagctcatctggcaaatgccaaaattgcaaggccgaacatcgtgacacgggttcgaacccggaacctcacag |
361094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 4464127 - 4464210
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||| |||| ||||||| ||||||||||||||||||||||| ||||||||| ||||||||||||| || ||||||||| |
|
|
| T |
4464127 |
gtctagaagttctagttcaactgacaaatgccgaaattgcaaggccggacgtcatgatccgggttcgaacctgggacctcacag |
4464210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 11572008 - 11572091
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||| |||||| ||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
11572008 |
gtctagaagtcctagctcaactaacaaatgcagaaattgtaaggccagacgtcgtgacccgggttcgaacccgggacctcacag |
11572091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 21037291 - 21037373
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||| |||| |||| |||||||||| |||| ||||||||| |
|
|
| T |
21037291 |
gtctagaagttctagctcaactggcaaatgctgaaattgcaaggccggacgttgtgactcgggttcgaatccgg-acctcacag |
21037373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 106 - 168
Target Start/End: Complemental strand, 35218756 - 35218694
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccggg |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||||||| |
|
|
| T |
35218756 |
gtctagaagtcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacccggg |
35218694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 106 - 186
Target Start/End: Complemental strand, 10226620 - 10226540
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctca |
186 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||| || | || || |||| ||||||||||||||| |||||| |
|
|
| T |
10226620 |
gtctagaagtcctagctcaactggcaaattccgaaattacaaagctggacttcgtgacacgggttcgaacccgggacctca |
10226540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 1241598 - 1241666
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
1241598 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
1241666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 2314724 - 2314656
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
2314724 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
2314656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 2959148 - 2959232
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||| | || |||| |||||||||||| ||||||||| |
|
|
| T |
2959148 |
tgtctagaagtcctaactcaactagcaaatgccgaaattgcaaggccggatatcgtgacttaggttcgaacccgagacctcacag |
2959232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 17534648 - 17534580
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
17534648 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
17534580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 106 - 178
Target Start/End: Complemental strand, 24619207 - 24619135
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccg |
178 |
Q |
| |
|
|||||||||||||| |||||||| |||||| | |||||| ||||||||||||| ||||||| |||||| |||| |
|
|
| T |
24619207 |
gtctagaagtcctaactcaactgacaaatgtcaaaattgtaaggccgaacgtcgtgacccgagttcgatcccg |
24619135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 105 - 148
Target Start/End: Original strand, 14939147 - 14939190
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaag |
148 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14939147 |
tgtctagaagtcctaactcaactggcaaatgccgaaattgcaag |
14939190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 101 - 178
Target Start/End: Original strand, 12252018 - 12252095
Alignment:
| Q |
101 |
tatctgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccg |
178 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||| |||| |||||||| ||| | ||| ||||| ||||| ||||||| |
|
|
| T |
12252018 |
tatccgtctagaagtcctagctcaactgacaaataccgagattgcaagaccggatgtcgtgaccagggtttgaacccg |
12252095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 8448267 - 8448199
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
8448267 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
8448199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 8457071 - 8457003
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
8457071 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
8457003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 8939629 - 8939697
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| || | ||||||||| |||||||||||| |
|
|
| T |
8939629 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccc |
8939697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 10263196 - 10263128
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
10263196 |
agaagtcctagctcaactggcaaagtgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
10263128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 18861892 - 18861824
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
18861892 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
18861824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 4610952 - 4610870
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||| |||||| |||| | |||||| ||||||||| |||| || |||||||||||||||||||| || ||||||||| |
|
|
| T |
4610952 |
gtctagaagttctagcttaactagaaaatgctgaaattgca-ggccagacatcatgacccgggttcgaacctgggacctcacag |
4610870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 110 - 189
Target Start/End: Complemental strand, 29009774 - 29009695
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| ||||| | ||||||| ||| ||| ||||||| ||||||||||||| |||||||| || ||||||||| |
|
|
| T |
29009774 |
agaagtcctagttcaacggacaaatgctgaagttgtaaggccggacgtcatgacccgaattcgaacctgggacctcacag |
29009695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 8329681 - 8329615
Alignment:
| Q |
112 |
aagtcctagctcaactggcaa-atgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
8329681 |
aagtcctagctcaactggcaatatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
8329615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 16496778 - 16496709
Alignment:
| Q |
110 |
agaagtcctagctcaactggc--aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
16496778 |
agaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
16496709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 105 - 143
Target Start/End: Complemental strand, 28592245 - 28592207
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaatt |
143 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28592245 |
tgtctagaagtcctagcttaactggcaaatgccgaaatt |
28592207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 25 - 82
Target Start/End: Original strand, 4918863 - 4918920
Alignment:
| Q |
25 |
ctctcatggtcatgaattaaacatgactttggagtaatttatttcaatcataaactac |
82 |
Q |
| |
|
|||||||| ||||||| |||| ||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
4918863 |
ctctcatgttcatgaactaaatctgactttggagtaatgtatttcaatcacaaactac |
4918920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 188
Target Start/End: Complemental strand, 584897 - 584830
Alignment:
| Q |
120 |
gctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
|||||||| ||||||||||||||||||||| || ||||| |||||||| |||||| ||| |||||||| |
|
|
| T |
584897 |
gctcaactagcaaatgccgaaattgcaagg-cggacgtcgtgacccggattcgaattcgggacctcaca |
584830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 15953237 - 15953305
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| || ||||| || |||||| |||||||||||| |
|
|
| T |
15953237 |
agaagtcctagctcaactggtaaaatgccgaaattgttagaccgaatgtaatgaccggggttcgaaccc |
15953305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 31205308 - 31205240
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||| | |||||||||||| |
|
|
| T |
31205308 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccc |
31205240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 32107960 - 32107892
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||| | | ||||||| | |||||||||||| |
|
|
| T |
32107960 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggctggatgtcatgatcggggttcgaaccc |
32107892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 110 - 189
Target Start/End: Complemental strand, 7197930 - 7197851
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||| || |||||||| |||||| || | | ||||| ||||||| |||||||||||| |||| |||| |
|
|
| T |
7197930 |
agaagtcctagctcaattgacaaatgccaaaattgtaaagttggacgtcttgacccgagttcgaacccgggaccttacag |
7197851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 110 - 176
Target Start/End: Complemental strand, 12795144 - 12795077
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaacc |
176 |
Q |
| |
|
|||||||||||||||||| | ||| ||||||||||| |||||| | ||||||||| ||||||||||| |
|
|
| T |
12795144 |
agaagtcctagctcaactagtaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaacc |
12795077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 33255489 - 33255571
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||| ||||||||||||| |||||||||||| |||||| ||||| | |||| ||||| | ||||||||| || ||||||||| |
|
|
| T |
33255489 |
gtctataagtcctagctcagctggcaaatgccaaaattgtaaggctggacgt-ttgacctgagttcgaacctgggacctcacag |
33255571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 175
Target Start/End: Original strand, 4083590 - 4083656
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaac |
175 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| || | | ||||||| |||||||||| |
|
|
| T |
4083590 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaac |
4083656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 188
Target Start/End: Complemental strand, 7487392 - 7487310
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||||||| |||| || |||| ||| || ||||| ||||| |||||||||| |
|
|
| T |
7487392 |
gtctagaagtcctagatcaaccggcaaatgtcgaaattacaagatcgggcgtcgtgagccaggttcaaacccagaacctcaca |
7487310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 107 - 144
Target Start/End: Original strand, 26269245 - 26269283
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc-aaatgccgaaattg |
144 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26269245 |
tctagaagtcctagctcaactggcaaaatgccgaaattg |
26269283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 735448 - 735516
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||| |||||| | | ||||| | |||||||||||| |
|
|
| T |
735448 |
agaagttctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccc |
735516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 10181048 - 10181116
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| || | ||| ||| | |||||||||||| |
|
|
| T |
10181048 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcgtgatcggggttcgaaccc |
10181116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 16244414 - 16244482
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||| |||| | | | ||||||| |||||||||||| |
|
|
| T |
16244414 |
agaagtcctagatcaactggcaaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccc |
16244482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 188
Target Start/End: Original strand, 19145489 - 19145552
Alignment:
| Q |
124 |
aactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
|||| |||||||| ||||||||||||||| ||||| |||||| | || |||||||| |||||||| |
|
|
| T |
19145489 |
aactagcaaatgctgaaattgcaaggccggacgtcgtgaccc-gttttgaacccgggacctcaca |
19145552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 21513075 - 21513143
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| |||||| | ||||||| |||||||||||| |
|
|
| T |
21513075 |
agaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgattggggttcgaaccc |
21513143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 189
Target Start/End: Original strand, 22576208 - 22576264
Alignment:
| Q |
133 |
atgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||| ||| ||||| || |||||| | ||||||||||||||||||||| |
|
|
| T |
22576208 |
atgccgaaattgaaagatcgaacatcgtgacccagattcgaacccggaacctcacag |
22576264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 77; Significance: 6e-36; HSPs: 70)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 10639735 - 10639651
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10639735 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacag |
10639651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 33083682 - 33083599
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33083682 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacag |
33083599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 11459714 - 11459798
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11459714 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggtcggacgtcatgacccgggttcgaacccgggacctcacag |
11459798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 26605624 - 26605707
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
26605624 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgttgtgacccgggttcgaacccgggacctcacag |
26605707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 106 - 188
Target Start/End: Original strand, 19048754 - 19048836
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
19048754 |
gtctagaagtcctagctcaactggcaaatgccgaaattgtaaggccggacgtcatgatccgggttcgaacccgggacctcaca |
19048836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 104 - 189
Target Start/End: Original strand, 19537305 - 19537390
Alignment:
| Q |
104 |
ctgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |||| ||| |||||||||||||||||||||||||| |
|
|
| T |
19537305 |
ctgtctagaagtcctagttcaactggcaaatgccgaaattgcaaggccggacgttgtgatccgggttcgaacccggaacctcacag |
19537390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 11816680 - 11816596
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| || ||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
11816680 |
tgtccagaagtcctagctcaactggcaaatgccgaaattgcaaggtcggacgtcgtgacctgggttcgaacccggaacctcacag |
11816596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 34460368 - 34460452
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||| |
|
|
| T |
34460368 |
tgtctagaagtcctagctcaactgacaaatgccgaaattgcaaggccggacgttgtgacccgggttcgaacccagaacctcacag |
34460452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 104 - 189
Target Start/End: Original strand, 11708676 - 11708761
Alignment:
| Q |
104 |
ctgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |||||||||||||||||| | ||||||||| |
|
|
| T |
11708676 |
ctgtctagaagtcctagctcaactggcaaatgccgaaattgtaaggccggacgttgtgacccgggttcgaacccaggacctcacag |
11708761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 105 - 185
Target Start/End: Original strand, 19816219 - 19816299
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctc |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
19816219 |
tgtctagaagtcctagctcaactggcaaataccgaaattgcaaggccggacgttgtgacccgggtttgaacccggaacctc |
19816299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 39535663 - 39535579
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| |||||||||||||||| ||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
39535663 |
tgtctagaagtcctaactcaactagcaaatgtcgaaattgcaaggccggacgtcgtgacccgggttcgaacccgggacctcacag |
39535579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 45125294 - 45125210
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |||| |||| |||||||||| ||||||||||||| |
|
|
| T |
45125294 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgtaaggccggacgttgtgacttgggttcgaactcggaacctcacag |
45125210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 110 - 185
Target Start/End: Complemental strand, 25501907 - 25501832
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctc |
185 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| ||||| ||||| ||||||||||||||||||| |
|
|
| T |
25501907 |
agaagtcctagctcaactggcaaatgctgaaattgcaaggccggacgtcgtgacctaggttcgaacccggaacctc |
25501832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 118 - 189
Target Start/End: Complemental strand, 37197726 - 37197655
Alignment:
| Q |
118 |
tagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
37197726 |
tagctcaactggcaaatgccgaaattgcaaggctggacgtcgtgacccgggttcgaacccgggacctcacag |
37197655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 106 - 176
Target Start/End: Complemental strand, 39831571 - 39831501
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacc |
176 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
39831571 |
gtctataagtcctagctcaactggcaaataccgaaattgcaaggccggacgtcatgatccgggttcgaacc |
39831501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 106 - 167
Target Start/End: Original strand, 42578180 - 42578241
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgg |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
42578180 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggtcggacgtcatgacccgg |
42578241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 105 - 177
Target Start/End: Complemental strand, 29659347 - 29659275
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||||||||| | |||||||||||||||||| |
|
|
| T |
29659347 |
tgtctagaagtcctagctcaactggcaaatgccaaaattgtaaggccgaacattgtgacccgggttcgaaccc |
29659275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 23839859 - 23839942
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||| |||| ||||| ||||||||||| || ||||||||| |
|
|
| T |
23839859 |
gtctagaagtcctaactcaactggcaaatgccaaaattgcaaggccggacgttgtgacctgggttcgaacctgggacctcacag |
23839942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 106 - 178
Target Start/End: Original strand, 15782590 - 15782662
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccg |
178 |
Q |
| |
|
||||| |||||||||||||| || ||||||||||||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
15782590 |
gtctaaaagtcctagctcaattgacaaatgccgaaattgtaaggtcggacgtcatgacccgggttcgaacccg |
15782662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 109 - 189
Target Start/End: Original strand, 16654366 - 16654446
Alignment:
| Q |
109 |
tagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||| ||| | ||| ||| |||||||||||||||||||||| |
|
|
| T |
16654366 |
tagaagtcctaactcaactgataaatgccgaaattgcaaggccggacgccgtgatccgagttcgaacccggaacctcacag |
16654446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 27138045 - 27137963
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||| |||||||||| || ||||| |||||||||||||| |||| |||| |
|
|
| T |
27138045 |
gtctagaagtcctagctcaactgacaaatgctgaaattg-aaggccgaacatcgtgacctgggttcgaacccgggaccttacag |
27137963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 106 - 176
Target Start/End: Complemental strand, 40786337 - 40786267
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacc |
176 |
Q |
| |
|
||||||||||| || |||||||| ||||||||||||||||||||||| ||||| |||||| |||||||||| |
|
|
| T |
40786337 |
gtctagaagtcataactcaactgacaaatgccgaaattgcaaggccggacgtcgtgaccctggttcgaacc |
40786267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 7276016 - 7275931
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||| |||||||| |||| |||||||||||||||| || | ||| || ||||||||||||||||| ||||||||| |
|
|
| T |
7276016 |
tgtctagaagtcctaactcaactgacaaaatgccgaaattgcaaggtcggatgtcgtggcccgggttcgaacccgggacctcacag |
7275931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 109 - 185
Target Start/End: Original strand, 4800879 - 4800955
Alignment:
| Q |
109 |
tagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctc |
185 |
Q |
| |
|
||||||| |||||||||| |||||||| |||||||||||||| | ||||| ||||| | |||||||||||||||||| |
|
|
| T |
4800879 |
tagaagttctagctcaaccggcaaatgtcgaaattgcaaggctggacgtcgtgacctgagttcgaacccggaacctc |
4800955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 4851319 - 4851403
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||| |||||||||||||||||| ||| ||||||||||| || |||| ||||| ||| |||||||| ||||||| ||||||||| |
|
|
| T |
4851319 |
tgtcttgaagtcctagctcaactgtcaattgccgaaattgtaaagccggacgtcgtgatccgggttcaaacccgggacctcacag |
4851403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 106 - 149
Target Start/End: Original strand, 34234530 - 34234573
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaagg |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34234530 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaagg |
34234573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 110 - 188
Target Start/End: Original strand, 43684073 - 43684151
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||| || |||||| |||||||||||||| ||| |||| |
|
|
| T |
43684073 |
agaagtcctatctcaactgacaaatgccgaaattgcaaggccggacaccatgacatgggttcgaacccgggaccccaca |
43684151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 15897217 - 15897285
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
15897217 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
15897285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 23080223 - 23080155
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
23080223 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
23080155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 109 - 176
Target Start/End: Complemental strand, 38440322 - 38440255
Alignment:
| Q |
109 |
tagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacc |
176 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||||||||||| ||||| |||||||| | |||||| |
|
|
| T |
38440322 |
tagaagttccagctcaactgacaaatgccgaaattgcaaggccggacgtcgtgacccggatccgaacc |
38440255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 45202000 - 45201917
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||| ||||| ||||||||| |||||||| |||| || |||| ||| ||| |||||||| ||||||||||||| |
|
|
| T |
45202000 |
gtctagaagtcctaactcaattggcaaatgtcgaaattgtaaggtcggtcgtcgtgatccgagttcgaactcggaacctcacag |
45201917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 188
Target Start/End: Original strand, 7349098 - 7349180
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
|||||||||||| | |||||||||||||||| || |||||||||||| ||||| ||| ||| ||||||| ||| |||||||| |
|
|
| T |
7349098 |
gtctagaagtccaatctcaactggcaaatgctgatattgcaaggccggacgtcgtgatccgagttcgaatccgagacctcaca |
7349180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 110 - 188
Target Start/End: Original strand, 42025674 - 42025752
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| ||||||| | ||| ||||| | |||||||||| |||||||||| |
|
|
| T |
42025674 |
agaagtcctagctcaactgacaaatgtcgaaattttaaggccggatgtcgtgacctgagttcgaacccagaacctcaca |
42025752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 162
Target Start/End: Complemental strand, 32844702 - 32844649
Alignment:
| Q |
109 |
tagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatga |
162 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32844702 |
tagaagttttagttcaactggcaaatgccgaaattgcaaggccggacgtcatga |
32844649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 2287434 - 2287366
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | |||||||| |||||||||||| |
|
|
| T |
2287434 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaaccc |
2287366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 6731545 - 6731613
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
6731545 |
agaagtcctagctcaactagcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
6731613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 13268100 - 13268032
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| || | ||||||||| |||||||||||| |
|
|
| T |
13268100 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccc |
13268032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 32023255 - 32023323
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
32023255 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
32023323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 34667047 - 34667115
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | ||||||||| | |||||||||| |
|
|
| T |
34667047 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggagttcgaaccc |
34667115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 42160382 - 42160314
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | ||||||| | |||||||||||| |
|
|
| T |
42160382 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccc |
42160314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 104 - 158
Target Start/End: Complemental strand, 8742728 - 8742674
Alignment:
| Q |
104 |
ctgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtc |
158 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||| |||| ||||||| |
|
|
| T |
8742728 |
ctgtctagaagtcctagctcaactgacaaaggccgaaattgttaggctgaacgtc |
8742674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 105 - 177
Target Start/End: Original strand, 39070017 - 39070090
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||| |||||||||||||||||||| ||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
39070017 |
tgtccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
39070090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 12236124 - 12236192
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
12236124 |
agaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
12236192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 20251610 - 20251542
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||| | |||||||||||| |
|
|
| T |
20251610 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccc |
20251542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 34481796 - 34481728
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||| | | | ||||||| |||||||||||| |
|
|
| T |
34481796 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccc |
34481728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 35476615 - 35476547
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
35476615 |
agaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccc |
35476547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 36754866 - 36754798
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | |||||| |||||||||||| |
|
|
| T |
36754866 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccc |
36754798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 38490525 - 38490457
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | |||||| |||||||||||| |
|
|
| T |
38490525 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgactggggttcgaaccc |
38490457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 41164773 - 41164705
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||| |||||| | |||||||| |||||||||||| |
|
|
| T |
41164773 |
agaagtcctagctcaactggcaaagtgtcgaaattgttaggccggatatcatgaccggggttcgaaccc |
41164705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 107 - 177
Target Start/End: Original strand, 18368794 - 18368865
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||| || | |||||| | |||||||||||| |
|
|
| T |
18368794 |
tctagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatatcatgatcggggttcgaaccc |
18368865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 102 - 189
Target Start/End: Complemental strand, 34239952 - 34239865
Alignment:
| Q |
102 |
atctgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||| ||||||||||||| ||| ||| |||||||||||||||| |||| | ||||| |||| || |||||||| | |||||| |||| |
|
|
| T |
34239952 |
atctatctagaagtcctaactctactagcaaatgccgaaattgtaaggtcagacgtcgtgactcgagttcgaactcagaaccttacag |
34239865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 110 - 176
Target Start/End: Complemental strand, 42200987 - 42200920
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacc |
176 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||| |||||| | ||||||| | ||||||||||| |
|
|
| T |
42200987 |
agaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgtcatgatcggggttcgaacc |
42200920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 43778581 - 43778526
Alignment:
| Q |
121 |
ctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacc |
176 |
Q |
| |
|
|||||||| ||||| |||||||||||| |||||| ||| ||||| ||||||||||| |
|
|
| T |
43778581 |
ctcaactgacaaataccgaaattgcaaagccgaatgtcgtgacctgggttcgaacc |
43778526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 4014936 - 4014870
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||| | |||||||| |||||||||||| |
|
|
| T |
4014936 |
aagtcctagctcaactgacaaaatgccgaaattgttaggccggatctcatgaccggggttcgaaccc |
4014870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 158
Target Start/End: Complemental strand, 6055131 - 6055081
Alignment:
| Q |
108 |
ctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtc |
158 |
Q |
| |
|
||||| |||||||||||| || |||||||| ||||||||||| |||||||| |
|
|
| T |
6055131 |
ctagatgtcctagctcaattgacaaatgccaaaattgcaaggtcgaacgtc |
6055081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 7975137 - 7975071
Alignment:
| Q |
112 |
aagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||| | | |||||| |||||||||||| |
|
|
| T |
7975137 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccc |
7975071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 14308864 - 14308814
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaac |
155 |
Q |
| |
|
|||||||||||||||||| ||||| ||| || |||||||| |||||||||| |
|
|
| T |
14308864 |
tgtctagaagtcctagctaaactgacaattgtcgaaattgtaaggccgaac |
14308814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 18469555 - 18469489
Alignment:
| Q |
112 |
aagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||| ||| | ||||| |||||| |
|
|
| T |
18469555 |
aagtcctagctcaactggctaaatgtcgaaattgttaggccgaacgtcttgatcggggtttgaaccc |
18469489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 174
Target Start/End: Complemental strand, 40825280 - 40825218
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaa |
174 |
Q |
| |
|
||||| ||||||||||| |||||||| ||||| |||| | ||||||||||||||||||||| |
|
|
| T |
40825280 |
aagtcatagctcaactgtcaaatgccaaaattataaggttggacgtcatgacccgggttcgaa |
40825218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 110 - 174
Target Start/End: Original strand, 40592316 - 40592381
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaa |
174 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| || | | ||||||| ||||||||| |
|
|
| T |
40592316 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaa |
40592381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 110 - 174
Target Start/End: Original strand, 45049388 - 45049453
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaa |
174 |
Q |
| |
|
||||||| ||||||||||||| ||||| |||||||| |||||| | ||||||||| ||||||||| |
|
|
| T |
45049388 |
agaagtcttagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaa |
45049453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 145
Target Start/End: Original strand, 13106355 - 13106395
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgc |
145 |
Q |
| |
|
||||||||||||||||||||||||| ||||| | ||||||| |
|
|
| T |
13106355 |
tgtctagaagtcctagctcaactggtaaatgtcaaaattgc |
13106395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 177
Target Start/End: Complemental strand, 15920727 - 15920671
Alignment:
| Q |
122 |
tcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
15920727 |
tcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
15920671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 23497637 - 23497569
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||||||| |||||| | ||| ||||| |||||||||||| |
|
|
| T |
23497637 |
agaagtcctagttcaactggtaaaatgccgaaattgttaggccggatgtcgtgaccggggttcgaaccc |
23497569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 23957055 - 23957123
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||| |||||||||||||| ||||| |||||||| |||||| | ||||||| | |||||||||||| |
|
|
| T |
23957055 |
agaagttctagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgatcggggttcgaaccc |
23957123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 33607046 - 33607114
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||| | | |||||| |||||||||||| |
|
|
| T |
33607046 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccagatgccatgactggggttcgaaccc |
33607114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 40812020 - 40812088
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||| |||||||| |||| ||||||||||| ||| || | ||||||||| |||||||||||| |
|
|
| T |
40812020 |
agaagtcctacctcaactgacaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccc |
40812088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 42007340 - 42007272
Alignment:
| Q |
110 |
agaagtcctagctcaactgg-caaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
42007340 |
agaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccc |
42007272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 43035443 - 43035511
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||| |||| |||| ||||||||| |||||| | ||||||| | |||||||||||| |
|
|
| T |
43035443 |
agaagtcctagctcaattggcaaaataccgaaattgttaggccggatgtcatgatcggggttcgaaccc |
43035511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 43461459 - 43461391
Alignment:
| Q |
110 |
agaagtcctagctcaactgg-caaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
43461459 |
agaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccc |
43461391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1348 (Bit Score: 76; Significance: 2e-35; HSPs: 1)
Name: scaffold1348
Description:
Target: scaffold1348; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 990 - 907
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
990 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacag |
907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 76; Significance: 2e-35; HSPs: 79)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 6602646 - 6602563
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6602646 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacag |
6602563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 6678099 - 6678016
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6678099 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacag |
6678016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 102 - 189
Target Start/End: Original strand, 32333110 - 32333197
Alignment:
| Q |
102 |
atctgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
32333110 |
atctgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgttgtgacccgggttcgaacccgggacctcacag |
32333197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 4531111 - 4531027
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4531111 |
tgtctagaagtcctagctcaattggcaaatgccgaaattgcaaggctggacgtcatgacccgggttcgaacccgggacctcacag |
4531027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 42192768 - 42192684
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| | ||||||| |
|
|
| T |
42192768 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgagttcgaacccgggatctcacag |
42192684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 70651 - 70568
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
70651 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggtcggacgtcatgacccgggtttgaacccgggacctcacag |
70568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 28817255 - 28817339
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| | ||||||| |
|
|
| T |
28817255 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgttgtgacccgggttcgaacccgggatctcacag |
28817339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 1078776 - 1078693
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||| |||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
1078776 |
gtctagaagtcgtagctcaactggtaaatgccgaaattgcaaggccggacgtcatgacccaggttcgaacccgggacctcacag |
1078693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 35779625 - 35779542
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
35779625 |
gtctagaagtcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacccgggttcgaacccgggacctcacag |
35779542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 105 - 188
Target Start/End: Original strand, 6099571 - 6099654
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| |||||||||||||||| ||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
6099571 |
tgtctagaagtcctagttcaacttgcaaatgtcgaaattgcaaggccggacgtcatgacccgagttcgaacccgaaacctcaca |
6099654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 10963368 - 10963285
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| || ||||||||||||| ||||||||| |
|
|
| T |
10963368 |
gtctagaagtcctagctcaactggcaaatgccgaaattacaaggccgaacgttgtgatccaggttcgaacccgggacctcacag |
10963285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 106 - 177
Target Start/End: Complemental strand, 12534846 - 12534775
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
12534846 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcgtgatccgggttcgaaccc |
12534775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 106 - 176
Target Start/End: Original strand, 40911221 - 40911291
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacc |
176 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
40911221 |
gtctagaagtgctagctcaactggcaaatgccgaaattgcaaggccggacgtcgtgacccgggttcgaacc |
40911291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 1469 - 1385
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||| |||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
1469 |
tgtctagaagttctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgaccctggttcgaacccgggacctcacag |
1385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 39303308 - 39303392
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
39303308 |
tgtcaagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacatgggtttgaacccgagacctcacag |
39303392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 45264768 - 45264685
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||| |||||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
45264768 |
tgtctagaagtcctaactcaactggcaaatgccgaaattgc-aggtcgaacgtcgtgactcgggttcgaacccgggacctcacag |
45264685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 7792661 - 7792744
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | |||| |||| ||||||||||||||| | ||||||| |
|
|
| T |
7792661 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggctggacgttgtgactcgggttcgaacccgggatctcacag |
7792744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 102 - 168
Target Start/End: Original strand, 29425353 - 29425419
Alignment:
| Q |
102 |
atctgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccggg |
168 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
29425353 |
atctgtctagaagtcctagctcaattggcaaatgccaaaattgcaaggccggacgtcatgacccggg |
29425419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 124 - 189
Target Start/End: Original strand, 42885192 - 42885257
Alignment:
| Q |
124 |
aactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | ||||||| |
|
|
| T |
42885192 |
aactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggatctcacag |
42885257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 18386707 - 18386791
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| |||||||||||| || | |||||||| ||||||||||||||| ||||||||| |
|
|
| T |
18386707 |
tgtctagaagttctagctcaactgacaaatgctgaaattgcaaggtcggatgtcatgactcgggttcgaacccgggacctcacag |
18386791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 7813322 - 7813405
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||| | || |||| ||||||||||||||| ||||||||| |
|
|
| T |
7813322 |
gtctagaagtcctagctcaaccggcaaatgctgaaattgcaaggccggatgttgtgactcgggttcgaacccgggacctcacag |
7813405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 22 - 103
Target Start/End: Complemental strand, 8021433 - 8021352
Alignment:
| Q |
22 |
tttctctcatggtcatgaattaaacatgactttggagtaatttatttcaatcataaactacatgcacgaataactaatatat |
103 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||| ||||||||||| |||||| |||||| || |||||||||| |
|
|
| T |
8021433 |
tttctctcatgctcatgaattaaaaatgactttggagtaatgtatttcaatcacaaactatatgcactaaccactaatatat |
8021352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 22 - 105
Target Start/End: Complemental strand, 8007784 - 8007701
Alignment:
| Q |
22 |
tttctctcatggtcatgaattaaacatgactttggagtaatttatttcaatcataaactacatgcacgaataactaatatatct |
105 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| || |||| |||||||||||||||||||| ||| ||| || ||||||||| |
|
|
| T |
8007784 |
tttctctcatgctcatgaattaaacatgacttttgaataatgtatttcaatcataaactacacgcatgaactaccaatatatct |
8007701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 39435282 - 39435365
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||| ||||||||||||||||||| | ||||||||||| || ||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
39435282 |
gtctagaagttctagctcaactggcaaatgtcaaaattgcaaggtcggacgtcatgatctgggttcgaacccgagacctcacag |
39435365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 177
Target Start/End: Original strand, 3822394 - 3822467
Alignment:
| Q |
104 |
ctgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||| |||| || |||| |||||||||||||||||| |
|
|
| T |
3822394 |
ctgtctagaagttctagttcaactggcaaatgccgaaattgtaaggtcggacgttgtgacccgggttcgaaccc |
3822467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 22979603 - 22979687
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |||||||| ||| || |||| || |||| ||||||||| |
|
|
| T |
22979603 |
tgtctagaagtcctagctcaactggcaaatgtcgaaattgcaagctcgaacgtcgtgatccaagttcaaagccgggacctcacag |
22979687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 106 - 186
Target Start/End: Complemental strand, 31969848 - 31969768
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctca |
186 |
Q |
| |
|
||||||||||| ||||| || ||||||||||||||||| ||||||| ||||||||| |||||||||||| ||| |||||| |
|
|
| T |
31969848 |
gtctagaagtcatagcttaattggcaaatgccgaaatttcaaggccagacgtcatgatccgggttcgaacacgggacctca |
31969768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 107 - 177
Target Start/End: Original strand, 44814863 - 44814934
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
44814863 |
tctagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
44814934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 187
Target Start/End: Complemental strand, 41849360 - 41849278
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcac |
187 |
Q |
| |
|
||||| |||||| || |||||||||||||||||||||||||||| || ||||| ||| | ||||||||| |||||||||||| |
|
|
| T |
41849360 |
tgtctggaagtcttaattcaactggcaaatgccgaaattgcaaggtcggacgtcgtgatctgggttcgaatccggaacctcac |
41849278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 4430860 - 4430792
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
4430860 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
4430792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 6317303 - 6317371
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
6317303 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
6317371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 130 - 189
Target Start/End: Original strand, 5385362 - 5385421
Alignment:
| Q |
130 |
caaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||| | ||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
5385362 |
caaatgccgaaattgcaaggctggacgtcgtgacccaggttcgaacccgggacctcacag |
5385421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 9292018 - 9292101
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| || |||| |||| ||||||| ||||||| ||| || |||||| |
|
|
| T |
9292018 |
gtctagaagtcctagctcaactggcaaatgtcgaaattgtaaagccggacgttgtgacccgaattcgaactcgggacttcacag |
9292101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 110 - 189
Target Start/End: Original strand, 18752345 - 18752424
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| ||||||| ||||| ||||||||| |||| || ||||| ||| | ||||||||||||||||||| |||| |
|
|
| T |
18752345 |
agaagtcctagttcaactgacaaataccgaaattgtaaggtcggacgtcgtgatcggggttcgaacccggaaccttacag |
18752424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 101 - 177
Target Start/End: Complemental strand, 38953614 - 38953537
Alignment:
| Q |
101 |
tatctgtctagaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||| || ||||||| |||||||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
38953614 |
tatctatccagaagtcttagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
38953537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 2733619 - 2733687
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
2733619 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
2733687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 4977159 - 4977091
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| || ||||||| |||||||||||| |
|
|
| T |
4977159 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggaccccatgaccggggttcgaaccc |
4977091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 91
Target Start/End: Complemental strand, 7992721 - 7992665
Alignment:
| Q |
35 |
catgaattaaacatgactttggagtaatttatttcaatcataaactacatgcacgaa |
91 |
Q |
| |
|
|||||||||| |||| ||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7992721 |
catgaattaattatgaattttgagtaatgtatttcaatcataaactacatgcacgaa |
7992665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 36 - 88
Target Start/End: Original strand, 18265167 - 18265219
Alignment:
| Q |
36 |
atgaattaaacatgactttggagtaatttatttcaatcataaactacatgcac |
88 |
Q |
| |
|
||||| ||||||||||||| ||||||| ||||||||||| ||||||||||||| |
|
|
| T |
18265167 |
atgaactaaacatgactttagagtaatgtatttcaatcacaaactacatgcac |
18265219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 36 - 88
Target Start/End: Original strand, 18274180 - 18274232
Alignment:
| Q |
36 |
atgaattaaacatgactttggagtaatttatttcaatcataaactacatgcac |
88 |
Q |
| |
|
||||| ||||||||||||| ||||||| ||||||||||| ||||||||||||| |
|
|
| T |
18274180 |
atgaactaaacatgactttagagtaatgtatttcaatcacaaactacatgcac |
18274232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 26690697 - 26690765
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
26690697 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
26690765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 26737974 - 26738042
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
26737974 |
agaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
26738042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 37295129 - 37295197
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
37295129 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
37295197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 177
Target Start/End: Complemental strand, 9998771 - 9998700
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||| |||||| | |||||||| |||||||||||| |
|
|
| T |
9998771 |
tctagaagtcctagttcaactggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaaccc |
9998700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 177
Target Start/End: Original strand, 10096612 - 10096683
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
10096612 |
tctagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccc |
10096683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 106 - 177
Target Start/End: Complemental strand, 41753108 - 41753037
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||| ||| | ||| ||| ||| ||||||||| |
|
|
| T |
41753108 |
gtctagaagtcctagctcaactgacaaatgtcgaaattgcaagaccggatgtcgtgatccgaattcgaaccc |
41753037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 105 - 147
Target Start/End: Complemental strand, 42364830 - 42364788
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaa |
147 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
42364830 |
tgtctagaagtcctatctcaactgccaaatgccgaaattgcaa |
42364788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 34 - 103
Target Start/End: Complemental strand, 2743536 - 2743467
Alignment:
| Q |
34 |
tcatgaattaaacatgactttggagtaatttatttcaatcataaactacatgcacgaataactaatatat |
103 |
Q |
| |
|
||||||| ||||||||| ||||||||||| |||||||||| ||| ||||||||| || |||||||||| |
|
|
| T |
2743536 |
tcatgaactaaacatgattttggagtaatgcatttcaatcacaaaatacatgcacaaaccactaatatat |
2743467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 5700771 - 5700706
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||| | | |||||| |||||||||||| |
|
|
| T |
5700771 |
aagtcctaactcaactggcaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccc |
5700706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 79
Target Start/End: Complemental strand, 8044626 - 8044569
Alignment:
| Q |
22 |
tttctctcatggtcatgaattaaacatgactttggagtaatttatttcaatcataaac |
79 |
Q |
| |
|
|||||||| || ||| |||||||| |||||||||||||||| ||||||||||| |||| |
|
|
| T |
8044626 |
tttctctcttgctcaagaattaaaaatgactttggagtaatgtatttcaatcacaaac |
8044569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 7772175 - 7772107
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| |||||| | ||||||| | |||||||||||| |
|
|
| T |
7772175 |
agaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccc |
7772107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 14188093 - 14188161
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
14188093 |
agaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgacctgggttcgaaccc |
14188161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 14243702 - 14243770
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| |||| ||| ||||||||| ||||||||||| |
|
|
| T |
14243702 |
agaagtcctagctcaactggtaaaatgccgaaattgttaggctgaatgtcatgaccgaggttcgaaccc |
14243770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 19649623 - 19649555
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
19649623 |
agaagtcatagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
19649555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 25250788 - 25250856
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
25250788 |
agaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaaccc |
25250856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 27928161 - 27928229
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| || ||| | | ||||||| |||||||||||| |
|
|
| T |
27928161 |
agaagtcctagctcaactggcaaaatgccgaaattgttagaccggatgccatgaccggggttcgaaccc |
27928229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 34711680 - 34711612
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| || | | ||||||| |||||||||||| |
|
|
| T |
34711680 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaaccc |
34711612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 35421743 - 35421675
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||| |||||||||||| || |||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
35421743 |
agaagtcctagttcaactggcaaaatgtcgaaattgttaggccgaatgccatgaccggggttcgaaccc |
35421675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 36586485 - 36586553
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| || | | ||||||| |||||||||||| |
|
|
| T |
36586485 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaaccc |
36586553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 9569728 - 9569795
Alignment:
| Q |
111 |
gaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
9569728 |
gaagtcttagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
9569795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 106 - 157
Target Start/End: Original strand, 20269542 - 20269593
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgt |
157 |
Q |
| |
|
||||| ||||| ||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
20269542 |
gtctaaaagtcttagctcaactggcaaataccgaaattgtaaggccggacgt |
20269593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 106 - 157
Target Start/End: Original strand, 21056171 - 21056222
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgt |
157 |
Q |
| |
|
||||| ||||| ||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
21056171 |
gtctaaaagtcttagctcaactggcaaataccgaaattgtaaggccggacgt |
21056222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 119 - 174
Target Start/End: Original strand, 22203713 - 22203768
Alignment:
| Q |
119 |
agctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaa |
174 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| | ||||| ||||||||||||||| |
|
|
| T |
22203713 |
agctcaactgacaaataccgaaattgcaaggtcagacgtcgtgacccgggttcgaa |
22203768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 105 - 188
Target Start/End: Complemental strand, 31695398 - 31695315
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
||||||||||| ||||||||||||||| ||| | ||||||||||| | | ||||||| ||| |||||||| || |||||||| |
|
|
| T |
31695398 |
tgtctagaagttctagctcaactggcacatgtcaaaattgcaaggttggatgtcatgattcggattcgaacctgggacctcaca |
31695315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 110 - 176
Target Start/End: Complemental strand, 38070606 - 38070539
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacc |
176 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| || |||||||| |
|
|
| T |
38070606 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgacatgaccgggattcgaacc |
38070539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 25063342 - 25063411
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa--tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
25063342 |
agaagtcctagttcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
25063411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 144
Target Start/End: Original strand, 29513879 - 29513913
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaatgccgaaattg |
144 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29513879 |
agaagtcctagctcaactgacaaatgccgaaattg |
29513913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 110 - 174
Target Start/End: Complemental strand, 6845108 - 6845043
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaa |
174 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||| |||||| | | ||||||| ||||||||| |
|
|
| T |
6845108 |
agaagtcctagctcaattggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaa |
6845043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 79
Target Start/End: Complemental strand, 8050928 - 8050871
Alignment:
| Q |
22 |
tttctctcatggtcatgaattaaacatgactttggagtaatttatttcaatcataaac |
79 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| |||||| | |||||||||| |||| |
|
|
| T |
8050928 |
tttctctcatgctcatgaattaaaaatgacttaggagtactgcatttcaatcacaaac |
8050871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 111 - 175
Target Start/End: Complemental strand, 33067512 - 33067447
Alignment:
| Q |
111 |
gaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaac |
175 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||| | | ||||| | |||||||||| |
|
|
| T |
33067512 |
gaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaac |
33067447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 10617788 - 10617856
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |||| |||||| | |||||||| |||||||||||| |
|
|
| T |
10617788 |
agaagtcctagctcaactgacaaaatgccgacattgttaggccggatgtcatgactggggttcgaaccc |
10617856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 20990538 - 20990470
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||| |||||||||||||| ||||||||| |||| ||| || | ||||||||| |||||||||||| |
|
|
| T |
20990538 |
agaagttctagctcaactggcaaaatgccgacattgttaggtcggatgtcatgaccagggttcgaaccc |
20990470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 24654977 - 24655045
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||| |||||| | | |||||| |||||||||||| |
|
|
| T |
24654977 |
agaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgactggggttcgaaccc |
24655045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 25213632 - 25213700
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| || ||| | | ||||| | |||||||||||| |
|
|
| T |
25213632 |
agaagtcctagctcaactggcaaaatgccgaaattgttagaccggatgccatgatcggggttcgaaccc |
25213700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 25893854 - 25893922
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||| |||||| | | ||||| | |||||||||||| |
|
|
| T |
25893854 |
agaagtcctagctcaactggcaaaatgctgaaattgttaggccggatgccatgatcggggttcgaaccc |
25893922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 26675560 - 26675628
Alignment:
| Q |
110 |
agaagtcctagctcaactgg-caaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||| | |||||||| ||||| |||||| |
|
|
| T |
26675560 |
agaagtcctagctcaactggtaaaatgccgaaattgttaggccggatatcatgaccggggtttgaaccc |
26675628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 175
Target Start/End: Original strand, 31291244 - 31291288
Alignment:
| Q |
131 |
aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaac |
175 |
Q |
| |
|
|||||||||||||| |||||||||||||||| | |||||||||| |
|
|
| T |
31291244 |
aaatgccgaaattgttaggccgaacgtcatgatcggggttcgaac |
31291288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 33128289 - 33128222
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaa--tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||| |||||||||| ||||| ||| ||||||| |||||||||||||||| | |||||||||||| |
|
|
| T |
33128289 |
aagtcatagctcaactagcaaaaatgctgaaattgttaggccgaacgtcatgatcggggttcgaaccc |
33128222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 43820871 - 43820939
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||| |||||| | | ||||| | |||||||||||| |
|
|
| T |
43820871 |
agaagtcctaactcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccc |
43820939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 76; Significance: 2e-35; HSPs: 76)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 34739280 - 34739363
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34739280 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacag |
34739363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 1173950 - 1174034
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
1173950 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacctgggttcgaacccgggacctcacag |
1174034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 43140034 - 43139951
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43140034 |
gtctagaagttctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccgggacctcacag |
43139951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 54768560 - 54768477
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||| |
|
|
| T |
54768560 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacccaggacctcacag |
54768477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 11277981 - 11278065
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| ||||||| ||||||||| |
|
|
| T |
11277981 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacatcatgacccgggttcaaacccgggacctcacag |
11278065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 18257328 - 18257412
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| ||||| ||||||||| |
|
|
| T |
18257328 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcatgatccgggttcgagcccgggacctcacag |
18257412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 53457823 - 53457907
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
53457823 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggtcggacgtcatgacccgggttcgaatccgggacctcacag |
53457907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 19849631 - 19849548
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||||||| ||||||||| |
|
|
| T |
19849631 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcgtgatccgggttcgaacccgggacctcacag |
19849548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 26424985 - 26424903
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26424985 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaagg-cggacgtcatgacccgggttcgaacccgggacctcacag |
26424903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 28798517 - 28798433
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |||| |||| |
|
|
| T |
28798517 |
tgtctagaagtcctagttcaactggcaaatgccgaaattgcaaggccggacgtcgtgacccgggttcgaacccgggaccttacag |
28798433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 32441212 - 32441129
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
32441212 |
gtctagaagtcctagctcaactggcaaatgtcgaaattgcaaggccagacatcatgacccgggttcgaacccgggacctcacag |
32441129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 104 - 189
Target Start/End: Complemental strand, 238588 - 238503
Alignment:
| Q |
104 |
ctgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| | ||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
238588 |
ctgtctagaagtcctagctcaactgtcaaatgccgaaattgcaaggctggacgccatgacctgggttcgaacccgggacctcacag |
238503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 108 - 188
Target Start/End: Original strand, 19225261 - 19225341
Alignment:
| Q |
108 |
ctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
19225261 |
ctagaagtcctagctcaactggcaaatgccgaaattgtaaagccggacgtcatgatccgggttcgaacccgggacctcaca |
19225341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 45874055 - 45874138
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
45874055 |
gtctagaagtcctagctcaactgacaaatgccaaaattgcaaggccggacgttgtgacccgggttcgaacccgggacctcacag |
45874138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 109 - 189
Target Start/End: Original strand, 22607988 - 22608068
Alignment:
| Q |
109 |
tagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||| || ||| |||||||||||||||| ||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
22607988 |
tagaagtcctagctcaactgacagatgtcgaaattgcaaggccggacgtcgtgacccgggttcgaacccgggacctcacag |
22608068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 23710461 - 23710378
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| |||||||||||| ||||| |||||||||||||||| ||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
23710461 |
gtctagaagtcatagctcaactggtaaatgtcgaaattgcaaggccggacgtcgtgacccggattcgaacctggaacctcacag |
23710378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 55214652 - 55214735
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| || |||||||| |||||||| |||||||||||||| ||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
55214652 |
gtctagaagtcttaactcaactgtcaaatgccaaaattgcaaggccggacgtcgtgacccgggttcgaacccgggacctcacag |
55214735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 106 - 186
Target Start/End: Complemental strand, 2864876 - 2864796
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctca |
186 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||| | ||||| ||||||||||||||||| |||||||| |
|
|
| T |
2864876 |
gtctagaagtcctaactcaactggcaaatgcctaaattgcaaggcgggacgtcgtgacccgggttcgaacctagaacctca |
2864796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 106 - 186
Target Start/End: Original strand, 55400228 - 55400308
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctca |
186 |
Q |
| |
|
|||||||| ||||| ||||||||| |||||||||||||||||||||| ||||||||| |||| ||||||| |||||||||| |
|
|
| T |
55400228 |
gtctagaaatcctaactcaactggtaaatgccgaaattgcaaggccggacgtcatgatccggattcgaactcggaacctca |
55400308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 105 - 188
Target Start/End: Complemental strand, 19674058 - 19673975
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
|||||||||||| |||||||||||| ||||| |||||||||||||||||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
19674058 |
tgtctagaagtcttagctcaactggtaaatgtagaaattgcaaggccgaacgttgtgacctgggttcgaacccgggacctcaca |
19673975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 114 - 179
Target Start/End: Complemental strand, 23417603 - 23417538
Alignment:
| Q |
114 |
gtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccgg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
23417603 |
gtcctagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacccgggttcgaacccgg |
23417538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 12767086 - 12767170
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||| || ||||||||| | ||||||||| ||| |||||||||| |
|
|
| T |
12767086 |
tgtctagaagtcctagctcaactggtaaatgccgaaattgtaagatcggacgtcatgatctgggttcgaatccgaaacctcacag |
12767170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 12867840 - 12867924
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||| || ||||| ||||||| ||||||||| || | ||||||| |
|
|
| T |
12867840 |
tgtctagaagttctagctcaactgtcaaatgccgaaattgcaaggtcggacgtcgtgacccgagttcgaacctgggatctcacag |
12867924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 37134048 - 37134131
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||| ||||| || | ||||||| ||||||||||||||| ||| |||||| |
|
|
| T |
37134048 |
gtctagaagtcctagttcaactggcaaatgctgaaattacaaggtcggatgtcatgatccgggttcgaacccgaaacttcacag |
37134131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 189
Target Start/End: Original strand, 12735429 - 12735514
Alignment:
| Q |
104 |
ctgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| |||||| |||||| |||| |||||||||||||||||| | ||||||||| |
|
|
| T |
12735429 |
ctgtctagaagtactagctcaactgacaaatgccaaaattgtaaggccagacgttgtgacccgggttcgaacccaggacctcacag |
12735514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 29581172 - 29581088
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||| |||||||||||||||| || || |||||||||||||||||||| ||||| ||||| |||||||||||| ||||||||| |
|
|
| T |
29581172 |
tgtcaagaagtcctagctcaattgtcagatgccgaaattgcaaggccggacgtcgtgacctaggttcgaacccgagacctcacag |
29581088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 109 - 188
Target Start/End: Original strand, 19814108 - 19814187
Alignment:
| Q |
109 |
tagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||| ||||||| ||||| ||||| |||||| |||| || |||||||| |
|
|
| T |
19814108 |
tagaagtcttagctcaactggcaaatgcagaaattgtaaggccggacgtcgtgacctgggttcaaacctgggacctcaca |
19814187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 115 - 177
Target Start/End: Complemental strand, 39284694 - 39284632
Alignment:
| Q |
115 |
tcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
39284694 |
tcctagctcaactggcaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
39284632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 22 - 88
Target Start/End: Complemental strand, 46144953 - 46144887
Alignment:
| Q |
22 |
tttctctcatggtcatgaattaaacatgactttggagtaatttatttcaatcataaactacatgcac |
88 |
Q |
| |
|
||||||||||| ||| ||| ||||||||||||||||||||| ||||||||||||||| | ||||||| |
|
|
| T |
46144953 |
tttctctcatgctcacgaactaaacatgactttggagtaatgtatttcaatcataaattgcatgcac |
46144887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 3848943 - 3848875
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
3848943 |
agaagtcctagctcaactggcaaaatgccgaaattgctaggccggatgccatgaccggggttcgaaccc |
3848875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 5397065 - 5396997
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
5397065 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
5396997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 9569478 - 9569546
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
9569478 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
9569546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 42154263 - 42154195
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
42154263 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
42154195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 107 - 177
Target Start/End: Complemental strand, 1033577 - 1033506
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
1033577 |
tctagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
1033506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 107 - 177
Target Start/End: Complemental strand, 47462164 - 47462093
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
47462164 |
tctagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
47462093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 186
Target Start/End: Original strand, 3465755 - 3465832
Alignment:
| Q |
109 |
tagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctca |
186 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||| |||| ||| || ||||||||| ||| |||||| |
|
|
| T |
3465755 |
tagaagtcctagctcaactagcaaatatcgaaattgcaaggccggacgttgtgatccaggttcgaactcgggacctca |
3465832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 1982564 - 1982632
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | ||||||||| |||||| ||||| |
|
|
| T |
1982564 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccgtatgtcatgaccggggttcaaaccc |
1982632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 12821168 - 12821236
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
12821168 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
12821236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 24712091 - 24712159
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| || | ||||||||| |||||||||||| |
|
|
| T |
24712091 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccc |
24712159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 35828277 - 35828345
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
35828277 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
35828345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 112 - 177
Target Start/End: Original strand, 46343333 - 46343400
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaa--tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||| ||||||||||| |||||||||||| |
|
|
| T |
46343333 |
aagtcctagctcaactgacaaaagtgccgaaattgttaggccggacgtcatgaccggggttcgaaccc |
46343400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 46488242 - 46488174
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | ||||||||| |||||| ||||| |
|
|
| T |
46488242 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcaaaccc |
46488174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 22910385 - 22910302
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| ||||||||| |||| | ||||||||||||| || ||||| ||||||||||||||||| || | ||||||| |
|
|
| T |
22910385 |
gtctagaagtctccgctcaactgacaaaagtcgaaattgcaaggtcggacgtcgtgacccgggttcgaacctgggatctcacag |
22910302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 22968137 - 22968220
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| ||||||||| |||| | ||||||||||||| || ||||| ||||||||||||||||| || | ||||||| |
|
|
| T |
22968137 |
gtctagaagtctccgctcaactgacaaaagtcgaaattgcaaggtcggacgtcgtgacccgggttcgaacctgggatctcacag |
22968220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 111 - 177
Target Start/End: Original strand, 37166142 - 37166209
Alignment:
| Q |
111 |
gaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||| | ||||||| | |||||||||||| |
|
|
| T |
37166142 |
gaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccc |
37166209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 117 - 177
Target Start/End: Original strand, 34684212 - 34684273
Alignment:
| Q |
117 |
ctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
34684212 |
ctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
34684273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 7512770 - 7512838
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
7512770 |
agaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaaccc |
7512838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 13389023 - 13389091
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||| ||| || | ||||||||| |||||||||||| |
|
|
| T |
13389023 |
agaagtcctagctcaactggcaaaatgctgaaattgttaggtcggatgtcatgaccggggttcgaaccc |
13389091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 18813373 - 18813441
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||| |||||| | ||||||||| || ||||||||| |
|
|
| T |
18813373 |
agaagtcctaactcaactggcaaaatgccgaaattgttaggccggatgtcatgaccgggcttcgaaccc |
18813441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 23974767 - 23974699
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | |||||||| | |||||||||| |
|
|
| T |
23974767 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatatcatgaccggtgttcgaaccc |
23974699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 24550816 - 24550884
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||| |||||| | ||||||| | |||||||||||| |
|
|
| T |
24550816 |
agaagtcttagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccc |
24550884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 29428058 - 29428126
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||| | ||||||| | |||||||||||| |
|
|
| T |
29428058 |
agaagtcctagctcaactggcaaaataccgaaattgttaggccggatgtcatgatcggggttcgaaccc |
29428126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 29648767 - 29648835
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| ||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
29648767 |
agaagtcctagctcaactagcaaaatgccgaatttgttaggccggatgtcatgaccagggttcgaaccc |
29648835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 30044709 - 30044641
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||| | |||||||||||| |
|
|
| T |
30044709 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccc |
30044641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 37050704 - 37050772
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
37050704 |
agaagtcttagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
37050772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 186
Target Start/End: Complemental strand, 49030863 - 49030787
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctca |
186 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||| ||||| ||| ||| ||||||| ||||||||||| |
|
|
| T |
49030863 |
tgtctagaagtcctagca----tggcaaatgtcgaaattgcaaggccggacgtcgtgatccgagttcgaa-ccggaacctca |
49030787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 49535888 - 49535956
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||| | |||||||||||| |
|
|
| T |
49535888 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccc |
49535956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 49882834 - 49882766
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| ||||||||||| |
|
|
| T |
49882834 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccc |
49882766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 24870601 - 24870667
Alignment:
| Q |
112 |
aagtcctagctcaactggc--aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacc |
176 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||| |||| |||||| |||||||||| |
|
|
| T |
24870601 |
aagtcctagctcaactggcaaaaatgccgaaattgttaggccggacgtaatgaccgaggttcgaacc |
24870667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 107 - 177
Target Start/End: Original strand, 28033192 - 28033263
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||| |||||||||||||||||| ||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
28033192 |
tctaaaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
28033263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 105 - 188
Target Start/End: Original strand, 32778124 - 32778207
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
||||||||| || ||| ||||||| ||||| || ||||||||||| || ||||| ||| |||||||||||| || |||||||| |
|
|
| T |
32778124 |
tgtctagaaatcatagatcaactgacaaataccaaaattgcaaggtcggacgtcgtgatccgggttcgaacacgagacctcaca |
32778207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 115 - 177
Target Start/End: Complemental strand, 51564511 - 51564448
Alignment:
| Q |
115 |
tcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||| |||||||| || |||||| ||| ||||||| |||||||||||| |
|
|
| T |
51564511 |
tcctagctcaactggcaaaatgccgaaactgttaggccggacgccatgaccagggttcgaaccc |
51564448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 118 - 176
Target Start/End: Complemental strand, 3890449 - 3890391
Alignment:
| Q |
118 |
tagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacc |
176 |
Q |
| |
|
||||||||||| ||||| |||||||| ||| ||| |||||||||||||| |||||||| |
|
|
| T |
3890449 |
tagctcaactgataaatgtcgaaattgtaagaccggacgtcatgacccggattcgaacc |
3890391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 109 - 143
Target Start/End: Complemental strand, 39800648 - 39800614
Alignment:
| Q |
109 |
tagaagtcctagctcaactggcaaatgccgaaatt |
143 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
39800648 |
tagaagtcctagctcaactgacaaatgccgaaatt |
39800614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 189
Target Start/End: Original strand, 39807869 - 39807927
Alignment:
| Q |
131 |
aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||| || || ||||||| |||||||| ||| ||||||||| |
|
|
| T |
39807869 |
aaatgccgaaattgcaaggccagacatcgtgacccgagttcgaactcgggacctcacag |
39807927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 107 - 144
Target Start/End: Complemental strand, 54908020 - 54907982
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc-aaatgccgaaattg |
144 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
54908020 |
tctagaagtcctagctcaactggcaaaatgccgaaattg |
54907982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 110 - 174
Target Start/End: Original strand, 35318543 - 35318608
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaa |
174 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||| |||||| | |||||||| ||||||||| |
|
|
| T |
35318543 |
agaagtcctaactcaactggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaa |
35318608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 110 - 174
Target Start/End: Original strand, 42856566 - 42856631
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaa |
174 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||| | ||||||||| |
|
|
| T |
42856566 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaa |
42856631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 189
Target Start/End: Original strand, 2075509 - 2075588
Alignment:
| Q |
109 |
tagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||| ||||| |||||||| ||||| | ||||||||||| || ||||||||| |||||||||||||| ||||||||| |
|
|
| T |
2075509 |
tagaaatcctacctcaactgccaaatatc-aaattgcaagggcggacgtcatgatttgggttcgaacccgggacctcacag |
2075588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 163
Target Start/End: Complemental strand, 17815265 - 17815213
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgac |
163 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
17815265 |
aagtcctagttcaactggcaaaatgccgaaattgttaggtcgaacgtcatgac |
17815213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 18371349 - 18371417
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||| |||||||| ||||||| ||||| |||||| |
|
|
| T |
18371349 |
agaagttctagctcaactggcaaaatgccgaaattgttaggccgaatatcatgactggggtttgaaccc |
18371417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 28010176 - 28010108
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||| |||| | | |||||||| |||||||||||| |
|
|
| T |
28010176 |
agaagtcctagctcaactggcaaaatgccaaaattgttaggcaggatatcatgaccggggttcgaaccc |
28010108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 29894413 - 29894481
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||| ||| || | ||||||||| |||||||||||| |
|
|
| T |
29894413 |
agaagtcctagctcaactggcaaaatgtcgaaattattaggtcggatgtcatgaccggggttcgaaccc |
29894481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 33416705 - 33416637
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| || ||| | ||||||| | |||||||||||| |
|
|
| T |
33416705 |
agaagtcctagctcaactggcaaaataccgaaattgttagaccggatgtcatgatcagggttcgaaccc |
33416637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 39301395 - 39301327
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| ||| |||||| | |||||||| |||||||||||| |
|
|
| T |
39301395 |
agaagtcctagttcaactggcaaactgccgaatttgttaggccggatatcatgaccagggttcgaaccc |
39301327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 42412113 - 42412045
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||| ||||| | | ||||||| |||||||||||| |
|
|
| T |
42412113 |
agaagtcatagctcaactggcaaaatgccgaaattgttaggccagatgccatgaccggggttcgaaccc |
42412045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 72; Significance: 6e-33; HSPs: 69)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 13203957 - 13204040
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
13203957 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcgtgacccgggttcgaacccgggacctcacag |
13204040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 105 - 188
Target Start/End: Complemental strand, 1191669 - 1191586
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||| |||||||||||||||| |||||||| |
|
|
| T |
1191669 |
tgtctagaagtcctagctcaactggcaaatgacgaaattgcaaggccggacgtcgtgatccgggttcgaacccgggacctcaca |
1191586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 9577089 - 9577006
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
9577089 |
gtctagaagtcctagctcaactggcaaatgctgaaattgcaaggccagacgtcatgacctgggttcgaacccagaacctcacag |
9577006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 104 - 189
Target Start/End: Complemental strand, 35317827 - 35317742
Alignment:
| Q |
104 |
ctgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||| ||| |||||||||| ||||||||| |
|
|
| T |
35317827 |
ctgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggtcggacgttatgacctggggtcgaacccgggacctcacag |
35317742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 110 - 189
Target Start/End: Original strand, 8734000 - 8734079
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
8734000 |
agaagtcctagctcaactggcaaatgctgaaattgcaaggccggacgtcgtgacctaggttcgaacccggaacctcacag |
8734079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 21018223 - 21018306
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
21018223 |
gtctagaagtcctagctcaactggcaaatgccaaaattgcgaggccggacgttgtgacccgggttcgaacccgggacctcacag |
21018306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 107 - 189
Target Start/End: Complemental strand, 4825066 - 4824984
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||||| ||||||| ||||||||| |
|
|
| T |
4825066 |
tctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgttgtgacccaggttcaaacccgggacctcacag |
4824984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 27721430 - 27721514
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| | || ||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
27721430 |
tgtctagaagtcctagctcaactggaaaatgccgaaattgcaaagtcggacgtcgtgacccgggtttgaacccgggacctcacag |
27721514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 105 - 181
Target Start/End: Complemental strand, 3387029 - 3386953
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaa |
181 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||| ||||| | | |||||||||||||||||| |
|
|
| T |
3387029 |
tgtctaaaagtcctagttcaactggcaaatgccgaaattgcaaggccggacgtcgttatccgggttcgaacccggaa |
3386953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 105 - 186
Target Start/End: Original strand, 11124651 - 11124732
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctca |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||| ||||| ||||| | ||||||||| |||||||| |
|
|
| T |
11124651 |
tgtctagaagtcctagctcaactggcaaatgtcaaaattgcaaggccggacgtcgtgaccttgattcgaacccagaacctca |
11124732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 106 - 186
Target Start/End: Original strand, 12257356 - 12257436
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctca |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||| ||||| |||||||||||| | |||||| |
|
|
| T |
12257356 |
gtctagaagtcctagctcaactggcaaatgccgaaattgtaaggccagacgttgtgacctgggttcgaacccaggacctca |
12257436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 106 - 172
Target Start/End: Original strand, 30127894 - 30127960
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcg |
172 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||| || || ||||||||||||| |
|
|
| T |
30127894 |
gtctagaagtcctagctcaacttgtaaatgccgaaattgcaaggccggacatcgtgacccgggttcg |
30127960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 106 - 168
Target Start/End: Original strand, 17465091 - 17465153
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccggg |
168 |
Q |
| |
|
||||| ||||||||||||| || |||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
17465091 |
gtctaaaagtcctagctcagctagcaaatgccgaaattgcaaggctggacgtcatgacccggg |
17465153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 107 - 189
Target Start/End: Complemental strand, 17984869 - 17984787
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||| ||| | |||||||||||| | ||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
17984869 |
tctagaagtcctagctcaactgaaaaaggtcgaaattgcaagattggacgtcctgactcgggttcgaacccggaacctcacag |
17984787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 106 - 168
Target Start/End: Complemental strand, 32143530 - 32143468
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccggg |
168 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||| |||| ||||||||| |
|
|
| T |
32143530 |
gtctagaagtcatagctcaactggcaaatgccaaaattgcaaggccggacgttgtgacccggg |
32143468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 187
Target Start/End: Original strand, 40177623 - 40177705
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcac |
187 |
Q |
| |
|
|||||||||||||||||| ||||| |||||| |||||||||||||||| |||| ||||| || ||| |||||||||| |||| |
|
|
| T |
40177623 |
tgtctagaagtcctagcttaactgacaaatgtcgaaattgcaaggccggacgttgtgacctggattccaacccggaacttcac |
40177705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 4164962 - 4165030
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
4164962 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
4165030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 133 - 189
Target Start/End: Complemental strand, 31909486 - 31909430
Alignment:
| Q |
133 |
atgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31909486 |
atgctgaaattgcaaggccagacgtcatgacccgggttcgaacccgggacctcacag |
31909430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 105 - 189
Target Start/End: Original strand, 35545932 - 35546016
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| ||| |||||||| |||||||||||||||||| ||||||||| ||| ||| |||||||| || ||||||||| |
|
|
| T |
35545932 |
tgtctagaagttctaactcaactgacaaatgccgaaattgcaaaaccgaacgtcgtgatccgaattcgaacctgggacctcacag |
35546016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 29265875 - 29265958
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||| ||||||| | ||||| ||||||| ||||| |||| || |||||||| ||||||||||| ||||||||| |
|
|
| T |
29265875 |
gtctagaagtcctaactcaactagaaaatgtcgaaattacaaggtcgaatgttgtgacccggattcgaacccgggacctcacag |
29265958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 189
Target Start/End: Original strand, 2970982 - 2971067
Alignment:
| Q |
104 |
ctgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||| |||| | |||| ||||||||||||||||| | ||||||||| |
|
|
| T |
2970982 |
ctgtctagaagtcctagctcaactgataaatgtcgaaattgtaaggtcagacgttgtgacccgggttcgaacctgagacctcacag |
2971067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 1244306 - 1244238
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
1244306 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
1244238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 109 - 185
Target Start/End: Original strand, 6020995 - 6021071
Alignment:
| Q |
109 |
tagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctc |
185 |
Q |
| |
|
||||||||||| ||||| ||||||||| | ||||||||||||| |||| |||||||| ||||||||||| ||||| |
|
|
| T |
6020995 |
tagaagtcctaactcaattggcaaatgtcaaaattgcaaggcctgacgttgtgacccggattcgaacccgggacctc |
6021071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 6672244 - 6672312
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
6672244 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
6672312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 17869249 - 17869181
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
17869249 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
17869181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 18473917 - 18473985
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
18473917 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
18473985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 106 - 186
Target Start/End: Original strand, 21112049 - 21112129
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctca |
186 |
Q |
| |
|
||||||||||||||||||| ||| |||||| ||||||||||||| | ||||| ||||| |||||||||| || |||||| |
|
|
| T |
21112049 |
gtctagaagtcctagctcagctgacaaatgtcgaaattgcaaggacatacgtcgtgacctaggttcgaacctgggacctca |
21112129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 23311298 - 23311230
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
23311298 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
23311230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 109 - 189
Target Start/End: Complemental strand, 28591475 - 28591395
Alignment:
| Q |
109 |
tagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||| || ||||||||||| | ||||||||||||||| |||| |||| ||||||| |||| | |||||||||| |
|
|
| T |
28591475 |
tagaagtcctaactaaactggcaaatactgaaattgcaaggccggacgtagtgactcgggttcaaacctgaaacctcacag |
28591395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 29119609 - 29119677
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
29119609 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
29119677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 36569282 - 36569350
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
36569282 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
36569350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 177
Target Start/End: Complemental strand, 6053179 - 6053108
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||| ||| || | ||||||||| |||||||||||| |
|
|
| T |
6053179 |
tctagaagtcctagctcaactgacaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccc |
6053108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 177
Target Start/End: Complemental strand, 25328432 - 25328361
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| ||||||||||| |
|
|
| T |
25328432 |
tctagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccc |
25328361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 110 - 144
Target Start/End: Complemental strand, 4444972 - 4444938
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaatgccgaaattg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4444972 |
agaagtcctagctcaactggcaaatgccgaaattg |
4444938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 21728663 - 21728732
Alignment:
| Q |
110 |
agaagtcctagctcaactggc--aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
21728663 |
agaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
21728732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 23074770 - 23074701
Alignment:
| Q |
110 |
agaagtcctagctcaactggc--aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
23074770 |
agaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
23074701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 112 - 185
Target Start/End: Original strand, 39143446 - 39143520
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctc |
185 |
Q |
| |
|
|||||||||||||||||||||| || |||||||| |||||||| | ||||||| ||||||||||||| ||||| |
|
|
| T |
39143446 |
aagtcctagctcaactggcaaaatgtcgaaattgttaggccgaatgccatgaccgaggttcgaacccggtacctc |
39143520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 105 - 150
Target Start/End: Original strand, 38955227 - 38955272
Alignment:
| Q |
105 |
tgtctagaagtcctagctcaactggcaaatgccgaaattgcaaggc |
150 |
Q |
| |
|
||||||||||| ||||||||||| | |||||||||||||||||||| |
|
|
| T |
38955227 |
tgtctagaagttctagctcaactagtaaatgccgaaattgcaaggc |
38955272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 9054096 - 9054028
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
9054096 |
agaagtcctagctcaactggcaaaataccgaaattgttaggccggatgccatgaccggggttcgaaccc |
9054028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 26802337 - 26802405
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||| || ||||||||||||| |||| |||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
26802337 |
agaagtcttaactcaactggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccc |
26802405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 26809887 - 26809955
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||| || ||||||||||||| |||| |||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
26809887 |
agaagtcttaactcaactggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccc |
26809955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 26824914 - 26824982
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||| || ||||||||||||| |||| |||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
26824914 |
agaagtcttaactcaactggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccc |
26824982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 28143357 - 28143289
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | |||||| |||||||||||| |
|
|
| T |
28143357 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgactggggttcgaaccc |
28143289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 36136987 - 36136919
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| |||||||| | |||||| |||||||||||| |
|
|
| T |
36136987 |
agaagtcctagctcaactagcaaaatgccgaaattgttaggccgaatgctatgaccggggttcgaaccc |
36136919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 42448214 - 42448282
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
42448214 |
agaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccc |
42448282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 107 - 157
Target Start/End: Original strand, 2755925 - 2755976
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgt |
157 |
Q |
| |
|
||||||||| ||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
2755925 |
tctagaagttctagctcaacttgataaatgccgaaattgcaaggccgaacgt |
2755976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 112 - 164
Target Start/End: Complemental strand, 8595611 - 8595557
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaa--tgccgaaattgcaaggccgaacgtcatgacc |
164 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||| ||||||||||| |
|
|
| T |
8595611 |
aagtcctagctcaactggcaaaaatgccgaaattgttaggccggacgtcatgacc |
8595557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 27023222 - 27023163
Alignment:
| Q |
22 |
tttctctcatggtcatgaattaaacatgactttggagtaatttatttcaatcataaacta |
81 |
Q |
| |
|
||||||||| | ||||||| |||||||||||||| |||||| ||||||||| | |||||| |
|
|
| T |
27023222 |
tttctctcaagttcatgaactaaacatgactttgaagtaatgtatttcaattacaaacta |
27023163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 107 - 177
Target Start/End: Original strand, 37940918 - 37940989
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||| |||||| | | ||||| | |||||||||||| |
|
|
| T |
37940918 |
tctagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgatcggggttcgaaccc |
37940989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 189
Target Start/End: Complemental strand, 3049173 - 3049099
Alignment:
| Q |
115 |
tcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||| |||||| |||||||| |||||||||||||| ||| | ||||||| ||| ||||||| ||||||||| |
|
|
| T |
3049173 |
tcctagttcaactcacaaatgccaaaattgcaaggccggacgccgtgacccgatttcaaacccgggacctcacag |
3049099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 184
Target Start/End: Original strand, 4925591 - 4925669
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacct |
184 |
Q |
| |
|
||||| |||||||| |||||| |||||||||||||| |||| | ||||||||||||| ||||||||| ||||||| |
|
|
| T |
4925591 |
gtctaaaagtcctaattcaactcataaatgccgaaattgtaaggtcagacgtcatgacccgcgttcgaacctggaacct |
4925669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 113 - 147
Target Start/End: Complemental strand, 15206855 - 15206821
Alignment:
| Q |
113 |
agtcctagctcaactggcaaatgccgaaattgcaa |
147 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15206855 |
agtcctagctcaactggtaaatgccgaaattgcaa |
15206821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 175
Target Start/End: Original strand, 26526517 - 26526582
Alignment:
| Q |
112 |
aagtcctagctcaactggcaaa--tgccgaaattgcaaggccgaacgtcatgacccgggttcgaac |
175 |
Q |
| |
|
||||| |||||||||||||||| | ||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
26526517 |
aagtcttagctcaactggcaaaaataccgaaattgttaggccgaacgtcatgaccgaggttcgaac |
26526582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 175
Target Start/End: Original strand, 41562461 - 41562527
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaac |
175 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| | |||||||| |
|
|
| T |
41562461 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggagttcgaac |
41562527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 110 - 162
Target Start/End: Complemental strand, 12878243 - 12878190
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatga |
162 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | ||||||| |
|
|
| T |
12878243 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatga |
12878190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 671184 - 671116
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||| ||| || | ||||||| | |||||||||||| |
|
|
| T |
671184 |
agaagtcctagttcaactggcaaaatgccgaaattgttaggtcggatgtcatgatcggggttcgaaccc |
671116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 1287318 - 1287386
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||||||||| ||| || | ||||||||| |||||||||||| |
|
|
| T |
1287318 |
agaagtcctagctcaattggtaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccc |
1287386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 2103029 - 2103097
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||| | || ||||||||| |
|
|
| T |
2103029 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcgggattcgaaccc |
2103097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 4617891 - 4617823
Alignment:
| Q |
110 |
agaagtcctagctcaactgg-caaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
4617891 |
agaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccc |
4617823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 9902626 - 9902558
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | |||| | |||||||||||| |
|
|
| T |
9902626 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgctatgatcggggttcgaaccc |
9902558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 10154287 - 10154219
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||| |||||||| |||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
10154287 |
agaagtcctaactcaactgacaaaatgccgaaattgtcaggccggatgccatgaccggggttcgaaccc |
10154219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 16496603 - 16496671
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||| ||||||||| ||||| |||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
16496603 |
agaagtcctagttcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccc |
16496671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 177
Target Start/End: Complemental strand, 22792234 - 22792167
Alignment:
| Q |
112 |
aagtcctagctcaactggc--aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| || ||||| |||| |||||||||||| |
|
|
| T |
22792234 |
aagtcctagctcaactggcaaaaatgccgaaattgttaggtcggacgtcttgacaggggttcgaaccc |
22792167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 33028233 - 33028301
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||| ||||||| |||| |||| |||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
33028233 |
agaagtcctagttcaactgacaaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccc |
33028301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 118 - 177
Target Start/End: Original strand, 34930236 - 34930296
Alignment:
| Q |
118 |
tagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
34930236 |
tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
34930296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 169
Target Start/End: Original strand, 36726992 - 36727052
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggt |
169 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||| |
|
|
| T |
36726992 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggt |
36727052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 38682931 - 38682999
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||| |||| | | | ||||||| |||||||||||| |
|
|
| T |
38682931 |
agaagtcctagctcaactggcaaaatgccaaaattgttaggctggatgccatgaccggggttcgaaccc |
38682999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 39151051 - 39150983
Alignment:
| Q |
110 |
agaagtcctagctcaactgg-caaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
39151051 |
agaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccc |
39150983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 42068544 - 42068612
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||| |||| | | | ||||||| |||||||||||| |
|
|
| T |
42068544 |
agaagtcctagctcagctggcaaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccc |
42068612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 106 - 188
Target Start/End: Original strand, 114252 - 114334
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcaca |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
114252 |
gtctagaagtcctagctcaactggcaaatgccgaaattgtaaggccggacgtcatgatccgggttcgaacccgggacctcaca |
114334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 106 - 186
Target Start/End: Complemental strand, 10101 - 10021
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctca |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||||||| |||||| |
|
|
| T |
10101 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcgtaacccgggttcgaacccgggacctca |
10021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 56481 - 56564
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
56481 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggtcggacgttgtgacccgggttcgaacccgggacctcacag |
56564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 14079 - 13996
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||| ||| |||||||||||||||| ||||||||| |
|
|
| T |
14079 |
gtctagaagtcctagctcaactggcaaataccgaaattgcaaggccggacgttgtgatccgggttcgaacccgggacctcacag |
13996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 19759 - 19676
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||| ||| |||||||||||||||| ||||||||| |
|
|
| T |
19759 |
gtctagaagtcctagctcaactggcaaataccgaaattgcaaggccggacgttgtgatccgggttcgaacccgggacctcacag |
19676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0067 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: scaffold0067
Description:
Target: scaffold0067; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 110 - 174
Target Start/End: Original strand, 34822 - 34886
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaa |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||| |
|
|
| T |
34822 |
agaagtcctagctcaactggcaaatgccgaaattgcaaggccggacgtcgtgacatgggttcgaa |
34886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0053 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: scaffold0053
Description:
Target: scaffold0053; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 117 - 189
Target Start/End: Original strand, 22174 - 22246
Alignment:
| Q |
117 |
ctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||| ||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
22174 |
ctagctcaactgacaaatgccgaaattgtaaggccggacgtcgtgacccgggttcgagcccgggacctcacag |
22246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0360 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: scaffold0360
Description:
Target: scaffold0360; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 106 - 189
Target Start/End: Original strand, 14495 - 14578
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
||||| |||||||||| || ||| |||||| |||||||||||||||| ||||| ||| |||||||||||||||| ||||||||| |
|
|
| T |
14495 |
gtctataagtcctagcacagctgacaaatgtcgaaattgcaaggccggacgtcgtgatccgggttcgaacccgggacctcacag |
14578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0495 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: scaffold0495
Description:
Target: scaffold0495; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 106 - 186
Target Start/End: Complemental strand, 3339 - 3259
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctca |
186 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||| || | || || |||| ||||||||||||||| |||||| |
|
|
| T |
3339 |
gtctagaagtcctagctcaactggcaaattccgaaattacaaagctggacttcgtgacacgggttcgaacccgggacctca |
3259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0457 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0457
Description:
Target: scaffold0457; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 107 - 175
Target Start/End: Original strand, 6779 - 6848
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaac |
175 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||| | ||||||||| |||||||||| |
|
|
| T |
6779 |
tctagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaac |
6848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 9071 - 8988
Alignment:
| Q |
106 |
gtctagaagtcctagctcaactggcaaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaacccggaacctcacag |
189 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| ||||| | |||| |||| |||||||||||| | ||||||||| |
|
|
| T |
9071 |
gtctagaagttctagctcaactggtaaatgccgaaattgtaaggcgggacgttatgattcgggttcgaacctaggacctcacag |
8988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0432
Description:
Target: scaffold0432; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 9370 - 9438
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
9370 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
9438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0402 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0402
Description:
Target: scaffold0402; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 1366 - 1298
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
1366 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
1298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0287 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0287
Description:
Target: scaffold0287; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 1183 - 1115
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
1183 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
1115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0778 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0778
Description:
Target: scaffold0778; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 177
Target Start/End: Original strand, 818 - 889
Alignment:
| Q |
107 |
tctagaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
818 |
tctagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccc |
889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0595 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0595
Description:
Target: scaffold0595; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 112 - 177
Target Start/End: Original strand, 350 - 416
Alignment:
| Q |
112 |
aagtcctagctcaactggcaa-atgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
350 |
aagtcctagctcaactggcaatatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 8984 - 8916
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||| |||||| | ||||||||| ||||||||||| |
|
|
| T |
8984 |
agaagtcatagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccgaggttcgaaccc |
8916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 90572 - 90640
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||| | ||||||| | |||||||||||| |
|
|
| T |
90572 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggcctgatgtcatgatcggggttcgaaccc |
90640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 39438 - 39370
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa-tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
39438 |
agaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
39370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 177
Target Start/End: Original strand, 160450 - 160519
Alignment:
| Q |
110 |
agaagtcctagctcaactggcaaa--tgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
160450 |
agaagtcctagctcaactggtaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
160519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 177
Target Start/End: Complemental strand, 4140 - 4072
Alignment:
| Q |
110 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgaacgtcatgacccgggttcgaaccc |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| | |||| | | |||||| |||||||||||| |
|
|
| T |
4140 |
agaagtcctagctcaactggcaaaatgccgaaattgttaagccggatgccatgactggggttcgaaccc |
4072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University