View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13346_low_18 (Length: 308)
Name: NF13346_low_18
Description: NF13346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13346_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 18 - 293
Target Start/End: Original strand, 42910546 - 42910824
Alignment:
| Q |
18 |
aaaggaattctgtctgggattctagaaattgtgtt-aagagaatgtaacactgtctggttgattgtctgttctgctagtcttgggggtttctgttactgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42910546 |
aaaggaattctgtctgggattctagaaattgtgtttaagagaatgtaacactgtctggttgattgtctgttctgctagtcttgggggtttctgttactgt |
42910645 |
T |
|
| Q |
117 |
tgctggctttttgattgacctgttattggttgaatatggagtattttgctgctgatagggcggccttattttccatttctccgattttctttgttcaggg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42910646 |
tgctggctttttgattgacctgttattggttgaatatggagtattttgctgctgatagggtggccttattttccatttctccgattttctttgttcaggg |
42910745 |
T |
|
| Q |
217 |
gctgtttgtgagcgggcagtaagactgagtttgtttttcctc--tgtttgcaggggtaattcgtggggcaatattgaat |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
42910746 |
gctgtttgtgagcgggcagtaagactgagtttgtttttcctctgtgtttgcaggggtaattcgtggggcaattttgaat |
42910824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University