View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13346_low_23 (Length: 254)
Name: NF13346_low_23
Description: NF13346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13346_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 16 - 239
Target Start/End: Complemental strand, 19032597 - 19032376
Alignment:
| Q |
16 |
aaaatatcaatcatagagtatttacttaatttacagaaatagttatatacatatctgcaatttaaacatcaataacaaatctggtatttgggtttccatg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19032597 |
aaaatatcaatcatagagtatttacttaatttacagaaatagttatatacatatctgcaatttaaacatcaataacaaatctggtatttgggtttccatg |
19032498 |
T |
 |
| Q |
116 |
caacttcatatatcaaacccaattaaaaactatgcacgacgagcttttgttgctttctgtgtgatttgtacacaatacttctcacatgctgggctacatg |
215 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19032497 |
caacttcatat--caaacccaattaaaaactatgcacgacgagcttttgttgctttctctgtgatttgtacacaatacttctcacatgctgggctacatg |
19032400 |
T |
 |
| Q |
216 |
tatcgatcgtagcacctttctctt |
239 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
19032399 |
tatcgatcgtagcacctttctctt |
19032376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University