View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13347_high_4 (Length: 341)
Name: NF13347_high_4
Description: NF13347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13347_high_4 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 14 - 341
Target Start/End: Complemental strand, 28210139 - 28209812
Alignment:
| Q |
14 |
cagagagcaaacctgtgttggtgaagaattcatccaccaacagttgtcgcaaatcaggtcgtcgtgtagccttcgaagtgccttctggccacaaccacca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28210139 |
cagagagcaaacctgtgttggtgaagaattcatccaccaacagttgtcgcaaatcaggtcgtcgtgtagccttcgaagtgccttctggccacaaccacca |
28210040 |
T |
 |
| Q |
114 |
aagccattcctctggcctcgacaacaatattgacacctccattgatgattttgacaagggacaccacaatccatgttttttggcatgttgtgcatggtca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28210039 |
aagccattcctctggcctcgacaacaatattgacacctccattgatgattttgacaagggacaccacaatccatgttttttagcatgttgtgcatggtca |
28209940 |
T |
 |
| Q |
214 |
tgtcttgctatttttatatttgtcatagtttttctctttttagggatatcctatttggctttcctcaaagcagggatgcccaaagtcaatgtgaggacat |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28209939 |
tgtcttgctatttttatatttgtcatagtttttctctttttggggatatcctatttggctttcctcaaagcagggatgcccaaagtcaatgtgaggacat |
28209840 |
T |
 |
| Q |
314 |
tcaacatgacaaagttacaagtggattc |
341 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
28209839 |
tcaacatgacaaagttacaagtggattc |
28209812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University