View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13347_high_7 (Length: 237)
Name: NF13347_high_7
Description: NF13347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13347_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 9 - 221
Target Start/End: Original strand, 6227540 - 6227749
Alignment:
| Q |
9 |
tggtttatgcatctgtgtacatgtttacgttaaatgatagttgtttcttctttttgcttgcatctgtactatggatccttatgtacttttttgacaacag |
108 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6227540 |
tggtttatgcatctgtgt----gtttacgttaaatgatagttgtttcttctttttgcttgcatctgtactatggatccttatgtacttttttgacaacag |
6227635 |
T |
 |
| Q |
109 |
aaatttatctttt-aagttcagtttattcctttatgttttgaagattcctatttcataccatatatggaaagttcaaacatgtccaatgaagtatatatt |
207 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6227636 |
aaatttatctttttaagttcagtttattcctttatgttttgaagattcctatttcctaacatatatggaaagttcaaacatgtccaatgaagtatatatt |
6227735 |
T |
 |
| Q |
208 |
aggagtgtggttat |
221 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6227736 |
aggagtgtggttat |
6227749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 132 - 187
Target Start/End: Original strand, 6223087 - 6223142
Alignment:
| Q |
132 |
tattcctttatgttttgaagattcctatttcataccatatatggaaagttcaaaca |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
6223087 |
tattcctttatgttttgaagattcctatttcctaccatatatggaaaggtcaaaca |
6223142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University