View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13347_high_9 (Length: 210)

Name: NF13347_high_9
Description: NF13347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13347_high_9
NF13347_high_9
[»] chr8 (2 HSPs)
chr8 (18-194)||(8001698-8001877)
chr8 (83-150)||(25004025-25004092)
[»] chr1 (2 HSPs)
chr1 (67-138)||(13270583-13270654)
chr1 (44-139)||(9320-9417)
[»] chr4 (1 HSPs)
chr4 (90-140)||(24854531-24854581)
[»] chr7 (3 HSPs)
chr7 (71-138)||(41572614-41572681)
chr7 (83-137)||(1454818-1454872)
chr7 (89-145)||(3737903-3737959)
[»] chr3 (3 HSPs)
chr3 (83-138)||(27170120-27170175)
chr3 (102-137)||(38094208-38094243)
chr3 (88-138)||(5548599-5548649)


Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 8001698 - 8001877
Alignment:
18 ggcagcatgatatgaactatgatagtatgtagattgtgatcctaggttttcctgatcactattaccctatgatagatggagcttactgagacattatgtc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||    
8001698 ggcagcatgatatgaactatgatagtatgtagattgtgatcctaggttttcctgatcactattactctatgatagatggagctcactgagacattatatc 8001797  T
118 tcatctcaatccatttatttttatttcatatatgcaggttgtacgagataaaggt---tagaacgcatctgactgatatt 194  Q
    | | || ||||||||||||||||||||||||| ||||||||||||||||||||||   ||||||||||||||||||||||    
8001798 ttaccttaatccatttatttttatttcatatacgcaggttgtacgagataaaggtaagtagaacgcatctgactgatatt 8001877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 83 - 150
Target Start/End: Original strand, 25004025 - 25004092
Alignment:
83 cctatgatagatggagcttactgagacattatgtctcatctcaatccatttatttttatttcatatat 150  Q
    |||| ||||| |||| || ||||||||||| ||||||| | |||||| ||||||||||||||| ||||    
25004025 cctaggataggtggaactcactgagacattctgtctcaccccaatccctttatttttatttcagatat 25004092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 67 - 138
Target Start/End: Original strand, 13270583 - 13270654
Alignment:
67 tcctgatcactattaccctatgatagatggagcttactgagacattatgtctcatctcaatccatttatttt 138  Q
    ||||||||||||| ||| || ||||| | ||||| ||||||| |||||| ||||| ||||||||||||||||    
13270583 tcctgatcactatcaccttaggataggtagagctcactgagatattatgactcatgtcaatccatttatttt 13270654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 139
Target Start/End: Complemental strand, 9417 - 9320
Alignment:
44 atgtagattgtgatcctaggttttcc--tgatcactattaccctatgatagatggagcttactgagacattatgtctcatctcaatccatttattttt 139  Q
    ||||||| |||| |||||||||| ||  ||| |||||  | |||| | ||| ||||||| ||| ||| ||||||||||||| ||||||||||||||||    
9417 atgtagactgtggtcctaggtttccccttgaccactaacaacctaggttaggtggagctcactaagatattatgtctcatcccaatccatttattttt 9320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 90 - 140
Target Start/End: Complemental strand, 24854581 - 24854531
Alignment:
90 tagatggagcttactgagacattatgtctcatctcaatccatttattttta 140  Q
    ||||||||||| ||||||||||||||||||||| |||||| ||||| ||||    
24854581 tagatggagctcactgagacattatgtctcatcccaatccttttatgttta 24854531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 71 - 138
Target Start/End: Original strand, 41572614 - 41572681
Alignment:
71 gatcactattaccctatgatagatggagcttactgagacattatgtctcatctcaatccatttatttt 138  Q
    ||||||||| |||| | ||||| |||| || ||||| || |||||||||||| |||||||||||||||    
41572614 gatcactatcacccaaggataggtggaactcactgataccttatgtctcatcccaatccatttatttt 41572681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 83 - 137
Target Start/End: Complemental strand, 1454872 - 1454818
Alignment:
83 cctatgatagatggagcttactgagacattatgtctcatctcaatccatttattt 137  Q
    |||| |||||||||| || ||||||||||| ||||||||| |||||| |||||||    
1454872 cctaggatagatggaactcactgagacattctgtctcatcccaatccttttattt 1454818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 89 - 145
Target Start/End: Original strand, 3737903 - 3737959
Alignment:
89 atagatggagcttactgagacattatgtctcatctcaatccatttatttttatttca 145  Q
    |||| |||| || |||||||||| |||||||| | |||||| |||||||||||||||    
3737903 ataggtggaactcactgagacatcatgtctcaccccaatccctttatttttatttca 3737959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 83 - 138
Target Start/End: Complemental strand, 27170175 - 27170120
Alignment:
83 cctatgatagatggagcttactgagacattatgtctcatctcaatccatttatttt 138  Q
    ||||||||||||||| || |||||||||| |||||||| |||||||  ||||||||    
27170175 cctatgatagatggaactcactgagacatcatgtctcacctcaatcattttatttt 27170120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 102 - 137
Target Start/End: Original strand, 38094208 - 38094243
Alignment:
102 actgagacattatgtctcatctcaatccatttattt 137  Q
    |||||||||||||||||||||||||||| |||||||    
38094208 actgagacattatgtctcatctcaatccttttattt 38094243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 88 - 138
Target Start/End: Original strand, 5548599 - 5548649
Alignment:
88 gatagatggagcttactgagacattatgtctcatctcaatccatttatttt 138  Q
    ||||| |||| || |||||||| ||||| ||||||||||||||||||||||    
5548599 gataggtggaactcactgagaccttatggctcatctcaatccatttatttt 5548649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University