View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13347_high_9 (Length: 210)
Name: NF13347_high_9
Description: NF13347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13347_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 8001698 - 8001877
Alignment:
| Q |
18 |
ggcagcatgatatgaactatgatagtatgtagattgtgatcctaggttttcctgatcactattaccctatgatagatggagcttactgagacattatgtc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| || |
|
|
| T |
8001698 |
ggcagcatgatatgaactatgatagtatgtagattgtgatcctaggttttcctgatcactattactctatgatagatggagctcactgagacattatatc |
8001797 |
T |
 |
| Q |
118 |
tcatctcaatccatttatttttatttcatatatgcaggttgtacgagataaaggt---tagaacgcatctgactgatatt |
194 |
Q |
| |
|
| | || ||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8001798 |
ttaccttaatccatttatttttatttcatatacgcaggttgtacgagataaaggtaagtagaacgcatctgactgatatt |
8001877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 83 - 150
Target Start/End: Original strand, 25004025 - 25004092
Alignment:
| Q |
83 |
cctatgatagatggagcttactgagacattatgtctcatctcaatccatttatttttatttcatatat |
150 |
Q |
| |
|
|||| ||||| |||| || ||||||||||| ||||||| | |||||| ||||||||||||||| |||| |
|
|
| T |
25004025 |
cctaggataggtggaactcactgagacattctgtctcaccccaatccctttatttttatttcagatat |
25004092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 67 - 138
Target Start/End: Original strand, 13270583 - 13270654
Alignment:
| Q |
67 |
tcctgatcactattaccctatgatagatggagcttactgagacattatgtctcatctcaatccatttatttt |
138 |
Q |
| |
|
||||||||||||| ||| || ||||| | ||||| ||||||| |||||| ||||| |||||||||||||||| |
|
|
| T |
13270583 |
tcctgatcactatcaccttaggataggtagagctcactgagatattatgactcatgtcaatccatttatttt |
13270654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 139
Target Start/End: Complemental strand, 9417 - 9320
Alignment:
| Q |
44 |
atgtagattgtgatcctaggttttcc--tgatcactattaccctatgatagatggagcttactgagacattatgtctcatctcaatccatttattttt |
139 |
Q |
| |
|
||||||| |||| |||||||||| || ||| ||||| | |||| | ||| ||||||| ||| ||| ||||||||||||| |||||||||||||||| |
|
|
| T |
9417 |
atgtagactgtggtcctaggtttccccttgaccactaacaacctaggttaggtggagctcactaagatattatgtctcatcccaatccatttattttt |
9320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 90 - 140
Target Start/End: Complemental strand, 24854581 - 24854531
Alignment:
| Q |
90 |
tagatggagcttactgagacattatgtctcatctcaatccatttattttta |
140 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||| ||||| |||| |
|
|
| T |
24854581 |
tagatggagctcactgagacattatgtctcatcccaatccttttatgttta |
24854531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 71 - 138
Target Start/End: Original strand, 41572614 - 41572681
Alignment:
| Q |
71 |
gatcactattaccctatgatagatggagcttactgagacattatgtctcatctcaatccatttatttt |
138 |
Q |
| |
|
||||||||| |||| | ||||| |||| || ||||| || |||||||||||| ||||||||||||||| |
|
|
| T |
41572614 |
gatcactatcacccaaggataggtggaactcactgataccttatgtctcatcccaatccatttatttt |
41572681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 83 - 137
Target Start/End: Complemental strand, 1454872 - 1454818
Alignment:
| Q |
83 |
cctatgatagatggagcttactgagacattatgtctcatctcaatccatttattt |
137 |
Q |
| |
|
|||| |||||||||| || ||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
1454872 |
cctaggatagatggaactcactgagacattctgtctcatcccaatccttttattt |
1454818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 89 - 145
Target Start/End: Original strand, 3737903 - 3737959
Alignment:
| Q |
89 |
atagatggagcttactgagacattatgtctcatctcaatccatttatttttatttca |
145 |
Q |
| |
|
|||| |||| || |||||||||| |||||||| | |||||| ||||||||||||||| |
|
|
| T |
3737903 |
ataggtggaactcactgagacatcatgtctcaccccaatccctttatttttatttca |
3737959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 83 - 138
Target Start/End: Complemental strand, 27170175 - 27170120
Alignment:
| Q |
83 |
cctatgatagatggagcttactgagacattatgtctcatctcaatccatttatttt |
138 |
Q |
| |
|
||||||||||||||| || |||||||||| |||||||| ||||||| |||||||| |
|
|
| T |
27170175 |
cctatgatagatggaactcactgagacatcatgtctcacctcaatcattttatttt |
27170120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 102 - 137
Target Start/End: Original strand, 38094208 - 38094243
Alignment:
| Q |
102 |
actgagacattatgtctcatctcaatccatttattt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38094208 |
actgagacattatgtctcatctcaatccttttattt |
38094243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 88 - 138
Target Start/End: Original strand, 5548599 - 5548649
Alignment:
| Q |
88 |
gatagatggagcttactgagacattatgtctcatctcaatccatttatttt |
138 |
Q |
| |
|
||||| |||| || |||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
5548599 |
gataggtggaactcactgagaccttatggctcatctcaatccatttatttt |
5548649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University