View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13349_high_2 (Length: 427)
Name: NF13349_high_2
Description: NF13349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13349_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 21 - 79
Target Start/End: Complemental strand, 19230906 - 19230848
Alignment:
| Q |
21 |
ttttatgctaaaccagtacacaatgagatatataacacctaaaaagagcttagaacatt |
79 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19230906 |
ttttatggtaaaccagtacacaatgagatatataacacctaaaaagagcttaaaacatt |
19230848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University