View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13349_high_4 (Length: 300)
Name: NF13349_high_4
Description: NF13349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13349_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 19 - 290
Target Start/End: Original strand, 50718462 - 50718733
Alignment:
| Q |
19 |
ctgttagcataaccttccaaggtttgtggcttatgttcatggggctcatgctttttacacctggttttgaaccgaaaggttgctttacgaaacttgaggg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50718462 |
ctgttagcataaccttccaaggtttgtggcttatgttcatggggctcatgctttttacacctggttttgaaccgaaaggttgctttacgaaacttgaggg |
50718561 |
T |
 |
| Q |
119 |
agatcaatatgttgttaagtgcagtgatgaaaaggctcttcatcgtgctgtttcattggtgaatcttcaattcagctggttcttgattggagtcactgtt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50718562 |
agatcaatatgttgttaagtgcagtgatgaaaaggctcttcatcgtgctgtttcattggtgaatcttcaattcagctggttcttgattggagtcactgtt |
50718661 |
T |
 |
| Q |
219 |
tttgctgtgtctttctacttgattatggctataagttatggcgaaaaagtaaagtatgtttcactgatgatg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50718662 |
tttgctgtgtctttctacttgattatggctataagttatggcgaaaaagtaaagtatgtttcactgatgatg |
50718733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 19 - 288
Target Start/End: Original strand, 50713181 - 50713450
Alignment:
| Q |
19 |
ctgttagcataaccttccaaggtttgtggcttatgttcatggggctcatgctttttacacctggttttgaaccgaaaggttgctttacgaaacttgaggg |
118 |
Q |
| |
|
|||||||||| | |||||||||||||| ||||||||||||| | |||||| || |||||||| | |||| ||||||||||| | || ||| || |
|
|
| T |
50713181 |
ctgttagcatgatcttccaaggtttgttcattatgttcatgggtttagtgctttctagacctggttatcaacccaaaggttgcttcttggaatatgaagg |
50713280 |
T |
 |
| Q |
119 |
agatcaatatgttgttaagtgcagtgatgaaaaggctcttcatcgtgctgtttcattggtgaatcttcaattcagctggttcttgattggagtcactgtt |
218 |
Q |
| |
|
|||||| | | ||| ||||| ||||||||||||| | ||||||||| |||||||||||||||||||||||||||||||||| |||||| ||||| || |
|
|
| T |
50713281 |
ggatcaacttatgattaggtgcaatgatgaaaaggctatgcatcgtgctatttcattggtgaatcttcaattcagctggttctttattggaatcactatt |
50713380 |
T |
 |
| Q |
219 |
tttgctgtgtctttctacttgattatggctataagttatggcgaaaaagtaaagtatgtttcactgatga |
288 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||| |||||||| ||| || ||||||||||| |
|
|
| T |
50713381 |
tttgtagtgtctttctacttgattatggctataatttatggtgaaaaagtggagtgtgattcactgatga |
50713450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University