View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13349_low_4 (Length: 352)
Name: NF13349_low_4
Description: NF13349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13349_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 41965418 - 41965198
Alignment:
| Q |
19 |
agtaatggcaaccgtgtttcaccataaatcgcattagacatacatcaatgttgtgatttattttaatttgcttttatccttcaaaatcaaattctctata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41965418 |
agtaatggcaaccgtgtttcaccataaatcgcattagacatacatcaatgttgtgatttattttaatttgcttttatccttcaaaatcaaattctctata |
41965319 |
T |
 |
| Q |
119 |
tagacatagatggaccggaaggtatgaagctcacctttgggataatacttgtagaagggaaggtcaatcaagaaaaggacgtcaaggtaacaacaaatta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41965318 |
tagacatagatggaccggaaggtatgaagctcacctttgggataatacttgtagaagggaaggtcagtcaagaaaaggacgtcaaggtaacaacaaatta |
41965219 |
T |
 |
| Q |
219 |
acttcaaaccacttaatgttt |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41965218 |
acttcaaaccacttaatgttt |
41965198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 306 - 344
Target Start/End: Complemental strand, 41965113 - 41965075
Alignment:
| Q |
306 |
actaacacatttccatttttcttcatcttgccctatgct |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41965113 |
actaacacatttccatttttcttcatcttgccctatgct |
41965075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 117 - 208
Target Start/End: Complemental strand, 24563213 - 24563122
Alignment:
| Q |
117 |
tatagacatagatggaccggaaggtatgaagctcacctttgggataatacttgtagaagggaaggtcaatcaagaaaaggacgtcaaggtaa |
208 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||| || |||||||| || |||||||| |
|
|
| T |
24563213 |
tatagacatagatggactggaaggtatgaagctcacctttgggataacagctgtagaagggaaggtcagtcgagaaaaggccgccaaggtaa |
24563122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 175
Target Start/End: Complemental strand, 30620032 - 30619980
Alignment:
| Q |
123 |
catagatggaccggaaggtatgaagctcacctttgggataatacttgtagaag |
175 |
Q |
| |
|
||||||||||| || || ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30620032 |
catagatggacagggagatatgaagctcacctttgggataatagttgtagaag |
30619980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 119 - 168
Target Start/End: Complemental strand, 16869959 - 16869910
Alignment:
| Q |
119 |
tagacatagatggaccggaaggtatgaagctcacctttgggataatactt |
168 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || |||||||| |||| |
|
|
| T |
16869959 |
tagacatagatggaccggaaggtttgaagctcatctatgggataagactt |
16869910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University